Mutagenetix > Incidental Mutation

Incidental Mutation 'R5023:Pkhd1l1'

391170

Institutional Source

Beutler Lab

Gene Symbol

Pkhd1l1

Ensembl Gene

ENSMUSG00000038725

Gene Name

polycystic kidney and hepatic disease 1-like 1

Synonyms

PKHDL1, D86 mRNA, fibrocystin L

MMRRC Submission

042614-MU

Accession Numbers

Genbank: NM_138674; MGI: 2183153

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5023 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44457494-44601369 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 44582227 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 3768 (M3768I)

Ref Sequence

ENSEMBL: ENSMUSP00000147447 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038336] [ENSMUST00000166957] [ENSMUST00000209244]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000038336
AA Change: M3768I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000036988
Gene: ENSMUSG00000038725
AA Change: M3768I

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IPT	30	141	9.02e-3	SMART
Pfam:TIG	146	255	1.6e-16	PFAM
IPT	269	362	2.27e-8	SMART
PbH1	398	420	2.98e3	SMART
IPT	1066	1154	5.34e-5	SMART
IPT	1156	1235	1.44e-1	SMART
Pfam:TIG	1240	1322	1.1e-13	PFAM
IPT	1328	1407	7.06e0	SMART
Pfam:TIG	1565	1645	5.1e-11	PFAM
IPT	1657	1743	1.89e-5	SMART
Pfam:TIG	1748	1828	2.1e-10	PFAM
IPT	1829	1910	4.87e-8	SMART
IPT	1914	1997	6.84e-3	SMART
IPT	1998	2085	9.86e-1	SMART
IPT	2089	2176	7.21e-11	SMART
PbH1	2105	2126	1.56e3	SMART
G8	2183	2303	2.37e-59	SMART
PbH1	2484	2506	9.48e3	SMART
PbH1	2507	2529	8.45e2	SMART
PbH1	2565	2587	4.11e3	SMART
PbH1	2664	2686	3.5e3	SMART
PbH1	2732	2755	2.7e3	SMART
Blast:G8	2949	2979	1e-5	BLAST
low complexity region	3014	3025	N/A	INTRINSIC
G8	3035	3173	6.5e-57	SMART
PbH1	3292	3314	1.96e3	SMART
PbH1	3354	3376	3.79e1	SMART
PbH1	3415	3437	4.87e2	SMART
PbH1	3470	3492	8.34e3	SMART
PbH1	3493	3514	5.86e3	SMART
low complexity region	3563	3574	N/A	INTRINSIC
low complexity region	4076	4103	N/A	INTRINSIC
low complexity region	4184	4212	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166957
AA Change: M3768I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000129522
Gene: ENSMUSG00000038725
AA Change: M3768I

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IPT	30	141	9.02e-3	SMART
Pfam:TIG	146	255	9.4e-18	PFAM
IPT	269	362	2.27e-8	SMART
PbH1	398	420	2.98e3	SMART
IPT	1066	1154	5.34e-5	SMART
IPT	1156	1235	1.44e-1	SMART
Pfam:TIG	1240	1323	3e-13	PFAM
IPT	1328	1407	7.06e0	SMART
Pfam:TIG	1565	1645	3.7e-11	PFAM
IPT	1657	1743	1.89e-5	SMART
Pfam:TIG	1748	1828	9.7e-12	PFAM
IPT	1829	1910	4.87e-8	SMART
IPT	1914	1997	6.84e-3	SMART
IPT	1998	2085	9.86e-1	SMART
IPT	2089	2176	7.21e-11	SMART
PbH1	2105	2126	1.56e3	SMART
G8	2183	2303	2.37e-59	SMART
PbH1	2484	2506	9.48e3	SMART
PbH1	2507	2529	8.45e2	SMART
PbH1	2565	2587	4.11e3	SMART
PbH1	2664	2686	3.5e3	SMART
PbH1	2732	2755	2.7e3	SMART
Blast:G8	2949	2979	1e-5	BLAST
low complexity region	3014	3025	N/A	INTRINSIC
G8	3035	3173	6.5e-57	SMART
PbH1	3292	3314	1.96e3	SMART
PbH1	3354	3376	3.79e1	SMART
PbH1	3415	3437	4.87e2	SMART
PbH1	3470	3492	8.34e3	SMART
PbH1	3493	3514	5.86e3	SMART
low complexity region	3563	3574	N/A	INTRINSIC
low complexity region	4076	4103	N/A	INTRINSIC
low complexity region	4184	4212	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209244
AA Change: M3768I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.1667

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

98% (127/129)

Allele List at MGI

Other mutations in this stock

Total: 123 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427D14Rik	A	T	11: 72,166,755	H739Q	probably benign	Het
Abca3	C	T	17: 24,374,300	R224C	probably damaging	Het
Abca8b	A	G	11: 109,974,988		probably null	Het
Adam1b	C	T	5: 121,501,159	V608M	probably damaging	Het
Ank2	A	G	3: 126,941,871		probably benign	Het
Ankrd17	A	C	5: 90,282,868	L1019R	probably damaging	Het
Arih1	T	C	9: 59,486,232	N39S	unknown	Het
Best3	G	A	10: 116,988,742	V38I	probably benign	Het
Bicc1	A	G	10: 70,947,883	S393P	possibly damaging	Het
C1d	T	A	11: 17,266,674	N135K	probably benign	Het
Cage1	G	T	13: 38,011,411	S778*	probably null	Het
Capn7	T	A	14: 31,352,426	V262E	probably damaging	Het
Ccdc190	A	G	1: 169,933,087	R95G	probably damaging	Het
Cd163	C	T	6: 124,325,288	T937I	probably damaging	Het
Cdh18	G	A	15: 23,259,666	S194N	probably damaging	Het
Clec4b2	A	T	6: 123,200,956	S77C	probably null	Het
Ctsw	T	A	19: 5,466,049	D237V	probably damaging	Het
Cyp2c68	G	A	19: 39,712,507	T289I	probably benign	Het
Cyp4f39	A	G	17: 32,481,104	Y133C	probably damaging	Het
Dlg5	T	C	14: 24,136,622	E1847G	probably damaging	Het
Dnah7a	C	A	1: 53,647,248	E248*	probably null	Het
Eef2kmt	T	A	16: 5,247,599	D248V	probably damaging	Het
Ewsr1	T	C	11: 5,088,054	T113A	possibly damaging	Het
Fbxo4	A	G	15: 3,977,756		probably null	Het
Fbxo43	A	T	15: 36,162,929	M44K	probably benign	Het
Fchsd1	A	G	18: 37,964,810	I340T	possibly damaging	Het
Fgf5	C	A	5: 98,262,015	A141E	probably damaging	Het
Gfm1	T	C	3: 67,473,544	V664A	probably damaging	Het
Glp2r	T	C	11: 67,741,032	T121A	possibly damaging	Het
Gm10803	A	C	2: 93,564,172	L96F	probably damaging	Het
Gm12169	T	A	11: 46,528,532	D58E	probably damaging	Het
Gm14569	T	C	X: 36,430,817	D1413G	probably benign	Het
Gm15455	T	C	1: 33,837,351		noncoding transcript	Het
Gm1818	G	C	12: 48,555,535		noncoding transcript	Het
Gm4907	G	A	X: 23,907,241	G327E	probably damaging	Het
Gm5155	A	T	7: 17,902,706	D236V	probably damaging	Het
Gm7030	A	G	17: 36,109,415		probably benign	Het
Gnb2	G	A	5: 137,529,940		probably null	Het
Gpc4	G	A	X: 52,074,563	R148C	probably damaging	Het
Gpx5	C	T	13: 21,288,745	V140I	probably damaging	Het
Gtpbp1	A	T	15: 79,719,221	Q637L	possibly damaging	Het
Herc1	A	T	9: 66,470,326	K3458M	possibly damaging	Het
Hhat	A	T	1: 192,727,339	L138Q	probably damaging	Het
Hipk1	G	T	3: 103,777,507	T264N	probably damaging	Het
Hjurp	A	T	1: 88,275,050	Y71N	possibly damaging	Het
Hnf4g	G	T	3: 3,644,587	A144S	probably damaging	Het
Hook3	TAGAG	TAG	8: 26,032,019		probably null	Het
Ifi204	G	A	1: 173,751,740	T513I	possibly damaging	Het
Ino80b	G	T	6: 83,125,042	S26R	probably damaging	Het
Ints9	T	A	14: 64,980,228	L68H	probably damaging	Het
Isx	C	T	8: 74,892,714	T178I	probably benign	Het
Kel	A	G	6: 41,688,111	L255P	probably damaging	Het
Klf11	T	A	12: 24,655,359	S271T	probably benign	Het
Klhl20	A	C	1: 161,109,220		probably null	Het
Lama2	G	A	10: 27,190,504	T1127I	probably damaging	Het
Larp1b	T	A	3: 41,033,985	N81K	possibly damaging	Het
Lsm11	T	C	11: 45,944,839	D25G	probably damaging	Het
Map3k20	T	A	2: 72,402,345		probably benign	Het
Mbd6	C	T	10: 127,286,441	V173I	probably benign	Het
Milr1	A	G	11: 106,766,965	D131G	possibly damaging	Het
Mybpc1	T	G	10: 88,543,774	D635A	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Ndufa7	A	G	17: 33,824,603		probably benign	Het
Ndufs3	C	A	2: 90,898,660	A161S	probably benign	Het
Neo1	T	C	9: 58,990,271	D134G	probably damaging	Het
Nme4	G	A	17: 26,093,668	T129I	probably benign	Het
Npffr2	A	T	5: 89,582,687	T159S	probably benign	Het
Nup153	A	T	13: 46,681,109		probably benign	Het
Olfr139	T	A	11: 74,045,055	D73V	probably damaging	Het
Olfr616	A	C	7: 103,565,171	M36R	possibly damaging	Het
Pate2	T	C	9: 35,686,111		probably benign	Het
Pcca	A	G	14: 122,790,398	N73D	probably damaging	Het
Pip5k1c	G	A	10: 81,310,889		probably null	Het
Ppa2	A	G	3: 133,370,434	M275V	probably benign	Het
Ptpn23	G	A	9: 110,388,556	T744I	probably benign	Het
Ptprv	A	T	1: 135,124,506		noncoding transcript	Het
Rad17	A	T	13: 100,645,063	H75Q	possibly damaging	Het
Rbm44	T	C	1: 91,169,098		probably null	Het
Rbpj	C	T	5: 53,649,415	R201W	probably damaging	Het
Rbpjl	C	A	2: 164,410,289	L215I	probably damaging	Het
Ror1	A	G	4: 100,425,932	E398G	probably benign	Het
Scamp3	T	A	3: 89,182,293		probably benign	Het
Selenot	CATGTATG	CATGTATGTATG	3: 58,588,453		probably null	Het
Siglec15	A	G	18: 78,048,675	C104R	probably damaging	Het
Sis	T	C	3: 72,934,122	I787V	probably benign	Het
Slc17a8	T	C	10: 89,576,560	D521G	probably benign	Het
Slc7a10	T	A	7: 35,197,355	M172K	possibly damaging	Het
Slco4c1	G	A	1: 96,841,228	P303L	probably damaging	Het
Slitrk3	T	C	3: 73,050,648	T264A	probably benign	Het
Smg8	A	C	11: 87,086,137	V206G	probably damaging	Het
Smg9	A	G	7: 24,405,872	K137R	possibly damaging	Het
Srrm2	C	A	17: 23,819,317		probably benign	Het
Sult2a2	T	A	7: 13,734,860	Y84N	possibly damaging	Het
Syngr2	A	T	11: 117,812,510	I34F	probably benign	Het
Tank	G	A	2: 61,578,635		probably benign	Het
Tead4	T	C	6: 128,294,171		probably benign	Het
Tex36	A	T	7: 133,595,290	C33S	probably benign	Het
Timm21	C	A	18: 84,949,414	V112L	possibly damaging	Het
Tmem240	T	A	4: 155,739,674	L92Q	probably damaging	Het
Tmem268	C	G	4: 63,568,540	S100C	probably damaging	Het
Tmod3	G	A	9: 75,511,206	P183S	probably damaging	Het
Trappc10	G	T	10: 78,217,160	F260L	possibly damaging	Het
Trim16	A	T	11: 62,836,812	Y233F	probably benign	Het
Trmt112	T	C	19: 6,910,753	V91A	probably benign	Het
Ttc3	A	G	16: 94,429,359	E450G	probably benign	Het
Ttk	A	G	9: 83,863,541	D647G	probably damaging	Het
Ubash3b	A	G	9: 41,037,459	C187R	possibly damaging	Het
Vmn1r29	T	A	6: 58,308,067	Y257*	probably null	Het
Vmn1r33	T	C	6: 66,612,105	N155S	probably benign	Het
Vmn2r28	T	A	7: 5,486,464	I459L	probably benign	Het
Vps16	A	G	2: 130,439,452	S235G	probably benign	Het
Vwde	T	C	6: 13,192,642	I421V	possibly damaging	Het
Xiap	T	C	X: 42,094,465	F23L	probably benign	Het
Xkr7	A	G	2: 153,054,380	T385A	probably benign	Het
Zbtb11	A	G	16: 56,006,065	Y819C	probably damaging	Het
Zfp112	A	G	7: 24,126,484	T624A	probably damaging	Het
Zfp592	A	G	7: 81,024,347	D353G	probably damaging	Het
Zfp62	T	A	11: 49,215,729	S216T	probably damaging	Het
Zfp677	A	T	17: 21,397,794	H371L	probably damaging	Het
Zfp780b	T	C	7: 27,963,448	K561E	possibly damaging	Het
Zfp936	G	A	7: 43,187,257	D31N	probably damaging	Het
Znfx1	T	C	2: 167,039,826	Y217C	probably damaging	Het
Zpbp	C	T	11: 11,415,248	E200K	probably benign	Het

Other mutations in Pkhd1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Pkhd1l1	APN	15	44477586	missense	probably damaging	1.00
IGL00235:Pkhd1l1	APN	15	44556019	missense	probably damaging	1.00
IGL00264:Pkhd1l1	APN	15	44491029	missense	possibly damaging	0.67
IGL00537:Pkhd1l1	APN	15	44591992	missense	possibly damaging	0.88
IGL00537:Pkhd1l1	APN	15	44500047	missense	probably benign	0.42
IGL00580:Pkhd1l1	APN	15	44586474	missense	probably damaging	0.98
IGL01085:Pkhd1l1	APN	15	44562752	splice site	probably null
IGL01089:Pkhd1l1	APN	15	44483869	splice site	probably benign
IGL01094:Pkhd1l1	APN	15	44546929	missense	probably benign	0.09
IGL01120:Pkhd1l1	APN	15	44505312	critical splice donor site	probably null
IGL01307:Pkhd1l1	APN	15	44530029	missense	possibly damaging	0.82
IGL01362:Pkhd1l1	APN	15	44532982	missense	probably benign	0.00
IGL01403:Pkhd1l1	APN	15	44483833	nonsense	probably null
IGL01546:Pkhd1l1	APN	15	44566316	missense	probably damaging	1.00
IGL01596:Pkhd1l1	APN	15	44529410	missense	possibly damaging	0.50
IGL01696:Pkhd1l1	APN	15	44529351	missense	possibly damaging	0.79
IGL01844:Pkhd1l1	APN	15	44499400	splice site	probably benign
IGL02007:Pkhd1l1	APN	15	44533733	splice site	probably benign
IGL02041:Pkhd1l1	APN	15	44493056	splice site	probably null
IGL02171:Pkhd1l1	APN	15	44516146	missense	possibly damaging	0.80
IGL02206:Pkhd1l1	APN	15	44512849	missense	probably benign	0.08
IGL02266:Pkhd1l1	APN	15	44573614	missense	probably damaging	1.00
IGL02487:Pkhd1l1	APN	15	44459426	missense	possibly damaging	0.65
IGL02488:Pkhd1l1	APN	15	44558597	missense	probably benign
IGL02522:Pkhd1l1	APN	15	44555902	missense	possibly damaging	0.71
IGL02554:Pkhd1l1	APN	15	44578500	missense	probably damaging	1.00
IGL02566:Pkhd1l1	APN	15	44526054	splice site	probably null
IGL02602:Pkhd1l1	APN	15	44557931	missense	probably damaging	1.00
IGL02606:Pkhd1l1	APN	15	44589456	missense	probably benign	0.00
IGL02623:Pkhd1l1	APN	15	44584873	missense	probably damaging	1.00
IGL02634:Pkhd1l1	APN	15	44539667	missense	probably damaging	1.00
IGL02637:Pkhd1l1	APN	15	44564324	missense	probably damaging	1.00
IGL02651:Pkhd1l1	APN	15	44483814	missense	probably damaging	1.00
IGL02679:Pkhd1l1	APN	15	44530045	critical splice donor site	probably null
IGL02684:Pkhd1l1	APN	15	44516209	critical splice donor site	probably null
IGL02739:Pkhd1l1	APN	15	44540950	missense	probably benign	0.11
IGL02831:Pkhd1l1	APN	15	44501493	missense	probably benign	0.18
IGL02839:Pkhd1l1	APN	15	44529543	missense	probably damaging	0.98
IGL02944:Pkhd1l1	APN	15	44501531	missense	probably damaging	1.00
IGL02957:Pkhd1l1	APN	15	44512908	missense	probably damaging	1.00
IGL03001:Pkhd1l1	APN	15	44558004	missense	probably damaging	1.00
IGL03030:Pkhd1l1	APN	15	44591976	missense	probably benign	0.00
IGL03030:Pkhd1l1	APN	15	44596902	missense	probably benign	0.41
IGL03132:Pkhd1l1	APN	15	44574617	missense	probably damaging	1.00
IGL03194:Pkhd1l1	APN	15	44518135	missense	probably damaging	1.00
IGL03219:Pkhd1l1	APN	15	44596895	missense	possibly damaging	0.62
IGL03236:Pkhd1l1	APN	15	44581826	missense	probably damaging	1.00
IGL03266:Pkhd1l1	APN	15	44538952	missense	probably damaging	1.00
IGL03276:Pkhd1l1	APN	15	44594584	missense	possibly damaging	0.77
IGL03284:Pkhd1l1	APN	15	44547518	splice site	probably benign
IGL03377:Pkhd1l1	APN	15	44484351	splice site	probably null
R0310_Pkhd1l1_251	UTSW	15	44522738	splice site	probably benign
R0344_Pkhd1l1_462	UTSW	15	44597011	missense	probably benign	0.15
R1737_Pkhd1l1_815	UTSW	15	44547509	critical splice donor site	probably null
R5049_Pkhd1l1_556	UTSW	15	44457616	missense	probably benign	0.00
K7371:Pkhd1l1	UTSW	15	44537442	missense	possibly damaging	0.67
K7371:Pkhd1l1	UTSW	15	44500067	missense	possibly damaging	0.94
N/A - 287:Pkhd1l1	UTSW	15	44582258	missense	probably damaging	0.98
P4717OSA:Pkhd1l1	UTSW	15	44523499	missense	probably benign	0.17
P4717OSA:Pkhd1l1	UTSW	15	44528247	missense	probably damaging	1.00
R0007:Pkhd1l1	UTSW	15	44574398	splice site	probably benign
R0020:Pkhd1l1	UTSW	15	44556872	missense	probably damaging	1.00
R0034:Pkhd1l1	UTSW	15	44504009	missense	probably benign	0.00
R0040:Pkhd1l1	UTSW	15	44573625	missense	probably damaging	1.00
R0050:Pkhd1l1	UTSW	15	44573807	missense	possibly damaging	0.79
R0050:Pkhd1l1	UTSW	15	44573807	missense	possibly damaging	0.79
R0063:Pkhd1l1	UTSW	15	44529237	missense	probably damaging	1.00
R0063:Pkhd1l1	UTSW	15	44529237	missense	probably damaging	1.00
R0086:Pkhd1l1	UTSW	15	44556008	missense	possibly damaging	0.94
R0103:Pkhd1l1	UTSW	15	44597141	missense	probably benign
R0103:Pkhd1l1	UTSW	15	44597141	missense	probably benign
R0127:Pkhd1l1	UTSW	15	44554605	missense	probably damaging	0.99
R0226:Pkhd1l1	UTSW	15	44526784	missense	possibly damaging	0.65
R0268:Pkhd1l1	UTSW	15	44597011	missense	probably benign	0.15
R0294:Pkhd1l1	UTSW	15	44560435	missense	probably benign	0.05
R0310:Pkhd1l1	UTSW	15	44522738	splice site	probably benign
R0344:Pkhd1l1	UTSW	15	44597011	missense	probably benign	0.15
R0449:Pkhd1l1	UTSW	15	44501519	missense	probably damaging	1.00
R0492:Pkhd1l1	UTSW	15	44519690	missense	probably benign	0.03
R0505:Pkhd1l1	UTSW	15	44589418	missense	probably damaging	1.00
R0529:Pkhd1l1	UTSW	15	44526754	missense	possibly damaging	0.62
R0543:Pkhd1l1	UTSW	15	44523491	critical splice acceptor site	probably null
R0552:Pkhd1l1	UTSW	15	44489546	missense	probably damaging	0.98
R0558:Pkhd1l1	UTSW	15	44484424	missense	probably damaging	0.97
R0609:Pkhd1l1	UTSW	15	44467424	missense	possibly damaging	0.48
R0619:Pkhd1l1	UTSW	15	44483838	missense	probably damaging	1.00
R0727:Pkhd1l1	UTSW	15	44535788	missense	possibly damaging	0.80
R0787:Pkhd1l1	UTSW	15	44529264	missense	probably damaging	1.00
R0846:Pkhd1l1	UTSW	15	44495597	missense	probably damaging	1.00
R0909:Pkhd1l1	UTSW	15	44538883	splice site	probably null
R0942:Pkhd1l1	UTSW	15	44532959	missense	probably benign	0.01
R1056:Pkhd1l1	UTSW	15	44591964	missense	probably damaging	1.00
R1147:Pkhd1l1	UTSW	15	44537441	missense	probably null	0.15
R1147:Pkhd1l1	UTSW	15	44537441	missense	probably null	0.15
R1187:Pkhd1l1	UTSW	15	44498051	missense	possibly damaging	0.65
R1328:Pkhd1l1	UTSW	15	44497996	missense	probably benign	0.01
R1331:Pkhd1l1	UTSW	15	44505547	missense	probably damaging	1.00
R1331:Pkhd1l1	UTSW	15	44589597	missense	probably damaging	1.00
R1332:Pkhd1l1	UTSW	15	44505547	missense	probably damaging	1.00
R1335:Pkhd1l1	UTSW	15	44505547	missense	probably damaging	1.00
R1338:Pkhd1l1	UTSW	15	44526724	missense	probably damaging	1.00
R1440:Pkhd1l1	UTSW	15	44540988	splice site	probably benign
R1445:Pkhd1l1	UTSW	15	44505644	missense	probably benign	0.32
R1458:Pkhd1l1	UTSW	15	44516115	missense	probably benign	0.01
R1469:Pkhd1l1	UTSW	15	44536886	missense	probably benign	0.45
R1469:Pkhd1l1	UTSW	15	44536886	missense	probably benign	0.45
R1500:Pkhd1l1	UTSW	15	44545494	missense	probably damaging	1.00
R1528:Pkhd1l1	UTSW	15	44526724	missense	probably damaging	1.00
R1542:Pkhd1l1	UTSW	15	44528191	missense	probably benign	0.44
R1568:Pkhd1l1	UTSW	15	44545501	splice site	probably null
R1571:Pkhd1l1	UTSW	15	44526841	missense	probably benign
R1572:Pkhd1l1	UTSW	15	44543473	missense	probably benign	0.01
R1604:Pkhd1l1	UTSW	15	44467367	nonsense	probably null
R1638:Pkhd1l1	UTSW	15	44597117	missense	probably benign	0.06
R1639:Pkhd1l1	UTSW	15	44540955	missense	probably damaging	0.99
R1737:Pkhd1l1	UTSW	15	44547509	critical splice donor site	probably null
R1816:Pkhd1l1	UTSW	15	44528239	missense	possibly damaging	0.91
R1826:Pkhd1l1	UTSW	15	44503345	missense	possibly damaging	0.75
R1880:Pkhd1l1	UTSW	15	44525242	missense	probably benign	0.13
R1930:Pkhd1l1	UTSW	15	44503337	missense	possibly damaging	0.69
R1933:Pkhd1l1	UTSW	15	44540884	missense	possibly damaging	0.48
R1938:Pkhd1l1	UTSW	15	44500038	missense	probably benign
R1975:Pkhd1l1	UTSW	15	44529713	missense	probably damaging	1.00
R1999:Pkhd1l1	UTSW	15	44499982	splice site	probably null
R2037:Pkhd1l1	UTSW	15	44568221	splice site	probably null
R2045:Pkhd1l1	UTSW	15	44479654	missense	probably damaging	1.00
R2049:Pkhd1l1	UTSW	15	44547513	splice site	probably benign
R2049:Pkhd1l1	UTSW	15	44581741	missense	probably damaging	1.00
R2063:Pkhd1l1	UTSW	15	44550752	missense	possibly damaging	0.69
R2072:Pkhd1l1	UTSW	15	44558639	missense	probably damaging	1.00
R2073:Pkhd1l1	UTSW	15	44558639	missense	probably damaging	1.00
R2075:Pkhd1l1	UTSW	15	44558639	missense	probably damaging	1.00
R2078:Pkhd1l1	UTSW	15	44527767	missense	probably benign	0.08
R2116:Pkhd1l1	UTSW	15	44569482	missense	probably damaging	0.97
R2133:Pkhd1l1	UTSW	15	44516185	missense	possibly damaging	0.91
R2138:Pkhd1l1	UTSW	15	44501457	missense	probably damaging	1.00
R2139:Pkhd1l1	UTSW	15	44529818	missense	possibly damaging	0.46
R2145:Pkhd1l1	UTSW	15	44512877	splice site	probably null
R2150:Pkhd1l1	UTSW	15	44499982	splice site	probably null
R2177:Pkhd1l1	UTSW	15	44459395	missense	probably benign
R2184:Pkhd1l1	UTSW	15	44499296	missense	possibly damaging	0.89
R2216:Pkhd1l1	UTSW	15	44573895	missense	probably damaging	1.00
R2226:Pkhd1l1	UTSW	15	44512792	missense	possibly damaging	0.79
R2227:Pkhd1l1	UTSW	15	44512792	missense	possibly damaging	0.79
R2243:Pkhd1l1	UTSW	15	44546927	missense	probably damaging	1.00
R2290:Pkhd1l1	UTSW	15	44528250	missense	probably benign	0.03
R2294:Pkhd1l1	UTSW	15	44479607	missense	probably damaging	0.99
R2346:Pkhd1l1	UTSW	15	44560506	missense	possibly damaging	0.82
R2356:Pkhd1l1	UTSW	15	44533019	missense	probably benign	0.00
R2386:Pkhd1l1	UTSW	15	44528178	missense	probably benign	0.00
R2404:Pkhd1l1	UTSW	15	44550820	missense	probably damaging	1.00
R2504:Pkhd1l1	UTSW	15	44485428	missense	probably damaging	0.97
R2679:Pkhd1l1	UTSW	15	44545386	missense	probably damaging	0.99
R2860:Pkhd1l1	UTSW	15	44540871	missense	probably damaging	1.00
R2861:Pkhd1l1	UTSW	15	44540871	missense	probably damaging	1.00
R2862:Pkhd1l1	UTSW	15	44540871	missense	probably damaging	1.00
R2972:Pkhd1l1	UTSW	15	44547248	missense	possibly damaging	0.65
R3016:Pkhd1l1	UTSW	15	44545370	missense	probably benign	0.02
R3162:Pkhd1l1	UTSW	15	44505528	missense	probably damaging	1.00
R3162:Pkhd1l1	UTSW	15	44505528	missense	probably damaging	1.00
R3416:Pkhd1l1	UTSW	15	44547364	missense	probably damaging	1.00
R3623:Pkhd1l1	UTSW	15	44526869	missense	probably damaging	1.00
R3687:Pkhd1l1	UTSW	15	44546587	missense	probably benign	0.17
R3755:Pkhd1l1	UTSW	15	44589406	missense	probably damaging	1.00
R3776:Pkhd1l1	UTSW	15	44514975	critical splice donor site	probably null
R3803:Pkhd1l1	UTSW	15	44493135	missense	probably benign	0.25
R3942:Pkhd1l1	UTSW	15	44592026	critical splice donor site	probably null
R4010:Pkhd1l1	UTSW	15	44529100	missense	possibly damaging	0.80
R4049:Pkhd1l1	UTSW	15	44498557	missense	probably damaging	1.00
R4059:Pkhd1l1	UTSW	15	44550760	missense	probably benign	0.01
R4179:Pkhd1l1	UTSW	15	44523649	missense	probably benign	0.45
R4184:Pkhd1l1	UTSW	15	44591906	missense	probably benign	0.00
R4369:Pkhd1l1	UTSW	15	44505553	missense	probably benign	0.00
R4462:Pkhd1l1	UTSW	15	44581804	missense	probably damaging	1.00
R4551:Pkhd1l1	UTSW	15	44550885	missense	probably damaging	1.00
R4618:Pkhd1l1	UTSW	15	44539682	missense	probably damaging	1.00
R4632:Pkhd1l1	UTSW	15	44484400	missense	probably benign	0.07
R4657:Pkhd1l1	UTSW	15	44547347	missense	probably damaging	1.00
R4716:Pkhd1l1	UTSW	15	44556032	missense	probably damaging	1.00
R4788:Pkhd1l1	UTSW	15	44498021	missense	probably damaging	0.99
R4828:Pkhd1l1	UTSW	15	44529405	missense	possibly damaging	0.55
R4858:Pkhd1l1	UTSW	15	44491101	missense	probably damaging	0.99
R4860:Pkhd1l1	UTSW	15	44537378	missense	possibly damaging	0.77
R4860:Pkhd1l1	UTSW	15	44537378	missense	possibly damaging	0.77
R4951:Pkhd1l1	UTSW	15	44533891	missense	possibly damaging	0.82
R4963:Pkhd1l1	UTSW	15	44504025	missense	probably benign	0.00
R5023:Pkhd1l1	UTSW	15	44528191	missense	probably benign	0.44
R5035:Pkhd1l1	UTSW	15	44568324	missense	probably damaging	1.00
R5049:Pkhd1l1	UTSW	15	44457616	missense	probably benign	0.00
R5065:Pkhd1l1	UTSW	15	44582293	missense	possibly damaging	0.68
R5089:Pkhd1l1	UTSW	15	44591887	missense	probably benign	0.01
R5151:Pkhd1l1	UTSW	15	44505309	missense	probably benign	0.00
R5153:Pkhd1l1	UTSW	15	44505309	missense	probably benign	0.00
R5189:Pkhd1l1	UTSW	15	44547148	missense	probably damaging	1.00
R5204:Pkhd1l1	UTSW	15	44547041	missense	possibly damaging	0.51
R5216:Pkhd1l1	UTSW	15	44495647	nonsense	probably null
R5286:Pkhd1l1	UTSW	15	44514972	nonsense	probably null
R5292:Pkhd1l1	UTSW	15	44529566	missense	probably damaging	1.00
R5293:Pkhd1l1	UTSW	15	44535750	missense	probably benign	0.01
R5298:Pkhd1l1	UTSW	15	44504046	missense	probably benign	0.00
R5327:Pkhd1l1	UTSW	15	44546862	missense	probably damaging	1.00
R5346:Pkhd1l1	UTSW	15	44540967	missense	probably damaging	1.00
R5481:Pkhd1l1	UTSW	15	44558646	missense	probably damaging	1.00
R5645:Pkhd1l1	UTSW	15	44532992	missense	probably benign	0.18
R5718:Pkhd1l1	UTSW	15	44545417	missense	probably damaging	1.00
R5809:Pkhd1l1	UTSW	15	44519707	missense	probably benign	0.03
R5816:Pkhd1l1	UTSW	15	44566322	missense	probably benign	0.01
R5854:Pkhd1l1	UTSW	15	44581790	missense	probably damaging	1.00
R5876:Pkhd1l1	UTSW	15	44578588	missense	possibly damaging	0.51
R5909:Pkhd1l1	UTSW	15	44526763	missense	probably damaging	1.00
R5950:Pkhd1l1	UTSW	15	44532965	missense	probably benign	0.00
R5961:Pkhd1l1	UTSW	15	44459463	missense	probably damaging	1.00
R5972:Pkhd1l1	UTSW	15	44545416	missense	probably damaging	1.00
R5975:Pkhd1l1	UTSW	15	44525988	missense	probably damaging	1.00
R5982:Pkhd1l1	UTSW	15	44489504	splice site	probably null
R6066:Pkhd1l1	UTSW	15	44528129	missense	probably damaging	0.99
R6122:Pkhd1l1	UTSW	15	44557940	missense	probably damaging	1.00
R6248:Pkhd1l1	UTSW	15	44529559	missense	probably benign
R6294:Pkhd1l1	UTSW	15	44570028	missense	probably damaging	1.00
R6301:Pkhd1l1	UTSW	15	44589525	missense	probably damaging	0.99
R6526:Pkhd1l1	UTSW	15	44498089	critical splice donor site	probably null
R6707:Pkhd1l1	UTSW	15	44529143	missense	probably benign
R6736:Pkhd1l1	UTSW	15	44557940	missense	probably damaging	1.00
R6753:Pkhd1l1	UTSW	15	44589663	missense	probably benign	0.45
R6815:Pkhd1l1	UTSW	15	44562655	missense	probably damaging	1.00
R6874:Pkhd1l1	UTSW	15	44589527	missense	probably benign	0.06
R6942:Pkhd1l1	UTSW	15	44522629	missense	probably damaging	1.00
R6970:Pkhd1l1	UTSW	15	44511674	missense	possibly damaging	0.61
R6982:Pkhd1l1	UTSW	15	44566268	missense	probably damaging	0.97
R7103:Pkhd1l1	UTSW	15	44573631	missense	probably benign	0.02
R7116:Pkhd1l1	UTSW	15	44557976	missense	probably benign	0.00
R7135:Pkhd1l1	UTSW	15	44584978	critical splice donor site	probably null
R7143:Pkhd1l1	UTSW	15	44573637	missense	possibly damaging	0.93
R7177:Pkhd1l1	UTSW	15	44467404	missense	probably damaging	1.00
R7194:Pkhd1l1	UTSW	15	44529116	missense	probably damaging	1.00
R7204:Pkhd1l1	UTSW	15	44523553	missense	possibly damaging	0.90
R7215:Pkhd1l1	UTSW	15	44528163	missense	possibly damaging	0.78
R7218:Pkhd1l1	UTSW	15	44522695	missense	possibly damaging	0.49
R7225:Pkhd1l1	UTSW	15	44546941	missense	probably damaging	1.00
R7283:Pkhd1l1	UTSW	15	44503280	missense	probably benign	0.10
R7292:Pkhd1l1	UTSW	15	44498590	missense	probably benign
R7304:Pkhd1l1	UTSW	15	44498482	missense	possibly damaging	0.94
R7349:Pkhd1l1	UTSW	15	44514954	missense	probably damaging	1.00
R7359:Pkhd1l1	UTSW	15	44589486	missense	probably damaging	1.00
R7407:Pkhd1l1	UTSW	15	44595011	missense	possibly damaging	0.75
R7475:Pkhd1l1	UTSW	15	44505185	nonsense	probably null
R7481:Pkhd1l1	UTSW	15	44512911	missense	probably benign
R7554:Pkhd1l1	UTSW	15	44495470	missense	probably damaging	1.00
R7555:Pkhd1l1	UTSW	15	44550761	missense	possibly damaging	0.51
R7562:Pkhd1l1	UTSW	15	44514930	missense	possibly damaging	0.68
R7583:Pkhd1l1	UTSW	15	44568364	critical splice donor site	probably null
R7595:Pkhd1l1	UTSW	15	44495521	missense	probably damaging	1.00
R7749:Pkhd1l1	UTSW	15	44527737	missense	probably benign	0.00
R7754:Pkhd1l1	UTSW	15	44586408	missense	possibly damaging	0.94
R7761:Pkhd1l1	UTSW	15	44529884	missense	probably benign	0.00
R7774:Pkhd1l1	UTSW	15	44540907	missense	probably benign	0.03
R7785:Pkhd1l1	UTSW	15	44543569	missense	probably damaging	1.00
R7790:Pkhd1l1	UTSW	15	44578581	missense	probably damaging	1.00
R7804:Pkhd1l1	UTSW	15	44597138	nonsense	probably null
R7864:Pkhd1l1	UTSW	15	44526053	critical splice donor site	probably null
R7883:Pkhd1l1	UTSW	15	44529126	missense	probably damaging	1.00
R8031:Pkhd1l1	UTSW	15	44512834	missense	probably damaging	1.00
R8128:Pkhd1l1	UTSW	15	44498053	missense	possibly damaging	0.94
R8142:Pkhd1l1	UTSW	15	44514931	missense	probably benign	0.00
R8150:Pkhd1l1	UTSW	15	44546659	missense	possibly damaging	0.68
R8209:Pkhd1l1	UTSW	15	44574407	missense	possibly damaging	0.46
R8212:Pkhd1l1	UTSW	15	44499300	missense	probably benign	0.12
R8226:Pkhd1l1	UTSW	15	44574407	missense	possibly damaging	0.46
R8248:Pkhd1l1	UTSW	15	44543546	missense	probably damaging	0.99
R8299:Pkhd1l1	UTSW	15	44581934	missense	probably benign	0.26
R8425:Pkhd1l1	UTSW	15	44574515	missense	probably benign	0.01
R8485:Pkhd1l1	UTSW	15	44560400	missense	probably damaging	0.98
R8486:Pkhd1l1	UTSW	15	44547416	missense	probably damaging	1.00
R8701:Pkhd1l1	UTSW	15	44574683	missense	probably damaging	1.00
R8709:Pkhd1l1	UTSW	15	44518174	missense	probably benign	0.01
R8777:Pkhd1l1	UTSW	15	44498571	missense	probably damaging	1.00
R8777-TAIL:Pkhd1l1	UTSW	15	44498571	missense	probably damaging	1.00
R8845:Pkhd1l1	UTSW	15	44505254	missense	probably benign	0.30
R8846:Pkhd1l1	UTSW	15	44546962	nonsense	probably null
R8863:Pkhd1l1	UTSW	15	44569986	nonsense	probably null
R8917:Pkhd1l1	UTSW	15	44533007	missense	probably benign	0.04
R8936:Pkhd1l1	UTSW	15	44538916	missense	possibly damaging	0.94
R8962:Pkhd1l1	UTSW	15	44536895	missense	probably damaging	1.00
R8971:Pkhd1l1	UTSW	15	44529519	missense	possibly damaging	0.68
R8973:Pkhd1l1	UTSW	15	44586437	missense	probably damaging	1.00
R8982:Pkhd1l1	UTSW	15	44523673	nonsense	probably null
R8994:Pkhd1l1	UTSW	15	44547103	missense	probably damaging	0.99
R9004:Pkhd1l1	UTSW	15	44543372	missense	probably benign	0.16
R9064:Pkhd1l1	UTSW	15	44562642	missense	possibly damaging	0.93
R9173:Pkhd1l1	UTSW	15	44520756	missense	probably benign	0.09
R9185:Pkhd1l1	UTSW	15	44589623	missense	probably benign	0.01
R9213:Pkhd1l1	UTSW	15	44495478	missense	probably damaging	1.00
R9218:Pkhd1l1	UTSW	15	44520726	missense	possibly damaging	0.90
R9256:Pkhd1l1	UTSW	15	44533894	critical splice donor site	probably null
R9291:Pkhd1l1	UTSW	15	44569976	missense	probably damaging	1.00
R9309:Pkhd1l1	UTSW	15	44536893	missense	probably benign	0.00
R9319:Pkhd1l1	UTSW	15	44529578	missense	possibly damaging	0.46
R9339:Pkhd1l1	UTSW	15	44589553	missense	probably damaging	1.00
R9366:Pkhd1l1	UTSW	15	44546912	missense	probably benign	0.03
R9444:Pkhd1l1	UTSW	15	44554657	missense	probably benign	0.00
R9464:Pkhd1l1	UTSW	15	44479613	missense	probably damaging	1.00
R9525:Pkhd1l1	UTSW	15	44584926	missense	possibly damaging	0.88
R9542:Pkhd1l1	UTSW	15	44546888	missense	probably benign	0.12
R9544:Pkhd1l1	UTSW	15	44546843	missense	probably damaging	1.00
R9608:Pkhd1l1	UTSW	15	44578633	missense	possibly damaging	0.65
R9673:Pkhd1l1	UTSW	15	44523505	missense	probably benign	0.22
R9771:Pkhd1l1	UTSW	15	44495487	missense	probably benign
R9792:Pkhd1l1	UTSW	15	44543587	missense	probably benign	0.00
R9793:Pkhd1l1	UTSW	15	44543587	missense	probably benign	0.00
R9795:Pkhd1l1	UTSW	15	44543587	missense	probably benign	0.00
RF006:Pkhd1l1	UTSW	15	44503238	missense	probably benign	0.03
RF006:Pkhd1l1	UTSW	15	44558507	critical splice acceptor site	probably benign
RF008:Pkhd1l1	UTSW	15	44558505	critical splice acceptor site	probably benign
RF012:Pkhd1l1	UTSW	15	44558505	critical splice acceptor site	probably benign
RF019:Pkhd1l1	UTSW	15	44558507	critical splice acceptor site	probably benign
RF030:Pkhd1l1	UTSW	15	44558502	critical splice acceptor site	probably benign
RF033:Pkhd1l1	UTSW	15	44558506	critical splice acceptor site	probably benign
RF038:Pkhd1l1	UTSW	15	44558503	critical splice acceptor site	probably benign
RF046:Pkhd1l1	UTSW	15	44558495	critical splice acceptor site	probably benign
X0027:Pkhd1l1	UTSW	15	44591966	missense	probably damaging	0.99
Z1177:Pkhd1l1	UTSW	15	44573576	missense	probably damaging	0.97
Z1177:Pkhd1l1	UTSW	15	44578578	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCCTGTAACTGAGAAAGCACC -3'
(R):5'- GTCAAATCTCACCATAGCACGTAG -3'

Sequencing Primer
(F):5'- TGTAACTGAGAAAGCACCTCATAAAG -3'
(R):5'- TCTCACCATAGCACGTAGATAATTC -3'

Posted On

2016-06-06