Mutagenetix > Incidental Mutation

Incidental Mutation 'R4303:Rfxank'

368333

Institutional Source

Beutler Lab

Gene Symbol

Rfxank

Ensembl Gene

ENSMUSG00000036120

Gene Name

regulatory factor X-associated ankyrin-containing protein

Synonyms

Tvl1

MMRRC Submission

041090-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4303 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70583444-70591804 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70588862 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 89 (D89G)

Ref Sequence

ENSEMBL: ENSMUSP00000148739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002418] [ENSMUST00000075724] [ENSMUST00000095273] [ENSMUST00000110139] [ENSMUST00000123760] [ENSMUST00000129668] [ENSMUST00000212320] [ENSMUST00000211898] [ENSMUST00000163756]

AlphaFold

Q9Z205

Predicted Effect

probably benign
Transcript: ENSMUST00000002418

SMART Domains

Protein: ENSMUSP00000002418
Gene: ENSMUSG00000002345

Domain	Start	End	E-Value	Type
Pfam:NEP	1	119	1.7e-51	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000075724
AA Change: D89G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075140
Gene: ENSMUSG00000036120
AA Change: D89G

Domain	Start	End	E-Value	Type
ANK	132	161	1.36e-2	SMART
ANK	165	194	5.16e-3	SMART
ANK	198	227	7.42e-4	SMART
ANK	231	260	2.35e3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000095273

SMART Domains

Protein: ENSMUSP00000092907
Gene: ENSMUSG00000071078

Domain	Start	End	E-Value	Type
SCOP:d1jhja_	22	64	6e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110139

SMART Domains

Protein: ENSMUSP00000105766
Gene: ENSMUSG00000002345

Domain	Start	End	E-Value	Type
Pfam:NEP	1	107	2.1e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123760

SMART Domains

Protein: ENSMUSP00000118102
Gene: ENSMUSG00000002345

Domain	Start	End	E-Value	Type
Pfam:NEP	1	78	2.4e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123976

Predicted Effect

probably benign
Transcript: ENSMUST00000129668

SMART Domains

Protein: ENSMUSP00000137694
Gene: ENSMUSG00000002345

Domain	Start	End	E-Value	Type
Pfam:NEP	1	78	2.4e-37	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212320
AA Change: D89G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212472

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212851

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211970

Predicted Effect

probably benign
Transcript: ENSMUST00000211898

Predicted Effect

probably benign
Transcript: ENSMUST00000163756

SMART Domains

Protein: ENSMUSP00000132314
Gene: ENSMUSG00000079033

Domain	Start	End	E-Value	Type
MADS	1	60	3.15e-34	SMART
low complexity region	97	114	N/A	INTRINSIC
low complexity region	285	297	N/A	INTRINSIC
low complexity region	320	335	N/A	INTRINSIC

Meta Mutation Damage Score

0.3259

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.1%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major histocompatibility (MHC) class II molecules are transmembrane proteins that have a central role in development and control of the immune system. The protein encoded by this gene, along with regulatory factor X-associated protein and regulatory factor-5, forms a complex that binds to the X box motif of certain MHC class II gene promoters and activates their transcription. Once bound to the promoter, this complex associates with the non-DNA-binding factor MHC class II transactivator, which controls the cell type specificity and inducibility of MHC class II gene expression. This protein contains ankyrin repeats involved in protein-protein interactions. Mutations in this gene have been linked to bare lymphocyte syndrome type II, complementation group B. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb8	T	C	5: 24,606,055 (GRCm39)	S247P	probably damaging	Het
Atg4b	A	G	1: 93,695,984 (GRCm39)	E41G	probably benign	Het
Bckdk	T	C	7: 127,504,502 (GRCm39)		probably benign	Het
Cacna2d1	A	G	5: 16,507,246 (GRCm39)		probably null	Het
Chaf1a	A	G	17: 56,351,068 (GRCm39)	D16G	unknown	Het
Defb12	A	G	8: 19,162,737 (GRCm39)	I65T	probably benign	Het
Dnah7c	T	C	1: 46,787,738 (GRCm39)	Y3264H	probably damaging	Het
Ehhadh	C	A	16: 21,581,602 (GRCm39)	K463N	probably damaging	Het
Ehmt2	G	A	17: 35,127,724 (GRCm39)	R901Q	possibly damaging	Het
Entrep1	G	A	19: 23,952,993 (GRCm39)	A439V	probably damaging	Het
Entrep1	C	T	19: 23,953,002 (GRCm39)	S436N	probably damaging	Het
Ern2	T	C	7: 121,777,069 (GRCm39)		probably null	Het
Esp6	A	G	17: 40,876,035 (GRCm39)	T28A	possibly damaging	Het
Gm17333	A	C	16: 77,649,767 (GRCm39)		noncoding transcript	Het
Heatr5a	T	C	12: 52,003,008 (GRCm39)	T165A	probably benign	Het
Hoxa5	T	C	6: 52,181,240 (GRCm39)	S31G	probably benign	Het
Ift80	A	G	3: 68,801,507 (GRCm39)	I744T	probably benign	Het
Kalrn	T	C	16: 34,055,761 (GRCm39)	K853E	probably damaging	Het
Krt36	A	T	11: 99,994,239 (GRCm39)	D279E	possibly damaging	Het
Map3k11	T	A	19: 5,740,852 (GRCm39)	V193E	probably damaging	Het
Mrgpra4	T	A	7: 47,630,684 (GRCm39)	M306L	probably benign	Het
Myo1a	A	G	10: 127,549,602 (GRCm39)	T428A	probably benign	Het
Nuggc	A	G	14: 65,848,621 (GRCm39)	H174R	possibly damaging	Het
Or14c40	G	A	7: 86,313,163 (GRCm39)	V98M	probably benign	Het
Or1e29	A	T	11: 73,667,664 (GRCm39)	M163K	possibly damaging	Het
Pigr	G	A	1: 130,769,554 (GRCm39)	D122N	probably benign	Het
Pik3ca	C	T	3: 32,494,084 (GRCm39)	R349*	probably null	Het
Rsf1	CGGCGGCGG	CGGCGGCGGTGGCGGCGG	7: 97,229,127 (GRCm39)		probably benign	Het
Serpina1a	A	G	12: 103,820,934 (GRCm39)	L348P	probably damaging	Het
Shank1	A	G	7: 43,991,898 (GRCm39)	Y701C	unknown	Het
Six4	G	T	12: 73,159,314 (GRCm39)	D207E	possibly damaging	Het
Slco3a1	G	T	7: 74,204,276 (GRCm39)	D21E	probably benign	Het
Sox6	C	T	7: 115,143,704 (GRCm39)		probably null	Het
Spta1	A	G	1: 174,007,418 (GRCm39)	N216S	probably damaging	Het
Stard13	T	C	5: 150,986,334 (GRCm39)	N392S	possibly damaging	Het
Tax1bp1	T	C	6: 52,704,263 (GRCm39)	V81A	possibly damaging	Het
Trim29	G	T	9: 43,222,419 (GRCm39)	V83L	probably damaging	Het
Vmn1r90	C	T	7: 14,295,495 (GRCm39)	W201*	probably null	Het
Wdr31	T	A	4: 62,378,626 (GRCm39)	N7I	probably damaging	Het
Ypel4	A	G	2: 84,567,151 (GRCm39)		probably benign	Het
Zfp39	T	C	11: 58,780,843 (GRCm39)	K640E	probably damaging	Het
Zfp579	A	G	7: 4,996,072 (GRCm39)		probably benign	Het
Zfp974	C	A	7: 27,609,657 (GRCm39)	K689N	possibly damaging	Het

Other mutations in Rfxank

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1576:Rfxank	UTSW	8	70,586,953 (GRCm39)	missense	possibly damaging	0.95
R7033:Rfxank	UTSW	8	70,590,820 (GRCm39)	missense	probably benign
R7355:Rfxank	UTSW	8	70,587,957 (GRCm39)	missense	probably damaging	1.00
R7385:Rfxank	UTSW	8	70,587,285 (GRCm39)	missense	probably damaging	1.00
R7399:Rfxank	UTSW	8	70,587,936 (GRCm39)	splice site	probably null
R8218:Rfxank	UTSW	8	70,584,085 (GRCm39)	splice site	probably null
R8377:Rfxank	UTSW	8	70,587,960 (GRCm39)	missense	probably damaging	1.00
R8476:Rfxank	UTSW	8	70,590,828 (GRCm39)	missense	probably benign	0.00
R9671:Rfxank	UTSW	8	70,588,198 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTCTAGCCACTGAGCCATAAG -3'
(R):5'- GTCTTCTTAAGCCTGGAGCC -3'

Sequencing Primer
(F):5'- GCACTTTACCCACTAAGCTACATTC -3'
(R):5'- TTCTTAAGCCTGGAGCCTGCAG -3'

Posted On

2016-01-28