Incidental Mutation 'R2915:Ice2'
ID 254852
Institutional Source Beutler Lab
Gene Symbol Ice2
Ensembl Gene ENSMUSG00000032235
Gene Name interactor of little elongation complex ELL subunit 2
Synonyms Narg2, B230343B06Rik
MMRRC Submission 040502-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.800) question?
Stock # R2915 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 69305185-69340360 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 69318122 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 241 (D241G)
Ref Sequence ENSEMBL: ENSMUSP00000034761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034761] [ENSMUST00000117246] [ENSMUST00000117610] [ENSMUST00000125938] [ENSMUST00000145538]
AlphaFold Q3UZ18
Predicted Effect probably benign
Transcript: ENSMUST00000034761
AA Change: D241G

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034761
Gene: ENSMUSG00000032235
AA Change: D241G

DomainStartEndE-ValueType
low complexity region 408 422 N/A INTRINSIC
low complexity region 434 473 N/A INTRINSIC
low complexity region 563 580 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Pfam:NARG2_C 726 936 1.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117246
Predicted Effect probably benign
Transcript: ENSMUST00000117610
Predicted Effect probably benign
Transcript: ENSMUST00000125938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151667
Predicted Effect probably benign
Transcript: ENSMUST00000145538
Meta Mutation Damage Score 0.0809 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,391,127 (GRCm39) P44L probably benign Het
Arhgap11a A G 2: 113,663,853 (GRCm39) V810A probably damaging Het
B3gnt6 T C 7: 97,842,800 (GRCm39) N387D probably benign Het
Col5a2 C G 1: 45,452,656 (GRCm39) G358R probably damaging Het
Cracr2a A G 6: 127,588,468 (GRCm39) K209R probably damaging Het
Dmkn A G 7: 30,464,741 (GRCm39) N32S unknown Het
Dusp13b T A 14: 21,790,205 (GRCm39) N47I probably damaging Het
Elmo2 A G 2: 165,139,573 (GRCm39) probably benign Het
Ephb6 T C 6: 41,591,172 (GRCm39) F110L probably damaging Het
Gabrb2 T A 11: 42,482,734 (GRCm39) N197K probably benign Het
Gdnf T A 15: 7,845,130 (GRCm39) V41E possibly damaging Het
Gm21915 A G 9: 40,582,083 (GRCm39) I59V possibly damaging Het
Gprin2 C T 14: 33,917,038 (GRCm39) G244D possibly damaging Het
Grin2d T C 7: 45,482,781 (GRCm39) probably benign Het
Mios C T 6: 8,214,935 (GRCm39) R44C possibly damaging Het
Nlrp5-ps T C 7: 14,320,636 (GRCm39) noncoding transcript Het
Nyap2 C T 1: 81,065,188 (GRCm39) R67* probably null Het
Or4d6 G A 19: 12,085,989 (GRCm39) P81L probably benign Het
Or4f14 G T 2: 111,743,064 (GRCm39) D70E probably damaging Het
Or5m8 T A 2: 85,822,389 (GRCm39) V76E probably damaging Het
Or5t9 T C 2: 86,659,570 (GRCm39) I158T probably benign Het
Or8g19 G T 9: 39,055,762 (GRCm39) R122L possibly damaging Het
Otop2 G A 11: 115,219,972 (GRCm39) A271T probably benign Het
Otulin A G 15: 27,619,716 (GRCm39) probably benign Het
Pax1 A G 2: 147,210,348 (GRCm39) Y361C probably damaging Het
Pcdhb12 A T 18: 37,570,693 (GRCm39) N613I probably damaging Het
Plekha5 A G 6: 140,534,925 (GRCm39) K173E probably damaging Het
Plin4 T A 17: 56,411,389 (GRCm39) T881S probably damaging Het
Poli A G 18: 70,655,771 (GRCm39) probably null Het
Prex2 T A 1: 11,240,077 (GRCm39) F898I probably damaging Het
Prr14l A T 5: 32,987,112 (GRCm39) H794Q probably benign Het
Prss1 A T 6: 41,439,545 (GRCm39) I93F probably benign Het
Ptpro C T 6: 137,391,239 (GRCm39) probably benign Het
Rad1 T C 15: 10,486,728 (GRCm39) C42R probably damaging Het
Rnf20 A G 4: 49,638,769 (GRCm39) E197G probably benign Het
Setx A G 2: 29,062,336 (GRCm39) E2260G probably damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Six2 A G 17: 85,992,616 (GRCm39) S296P probably damaging Het
Smg1 T A 7: 117,810,102 (GRCm39) probably benign Het
Spred2 T C 11: 19,948,215 (GRCm39) V41A probably damaging Het
Ssu2 A T 6: 112,354,566 (GRCm39) C219* probably null Het
Tbc1d9b T A 11: 50,040,563 (GRCm39) V360D possibly damaging Het
Tdrd9 G A 12: 112,006,895 (GRCm39) D920N probably damaging Het
Tyrp1 A G 4: 80,755,692 (GRCm39) T154A possibly damaging Het
Vrk3 C T 7: 44,424,866 (GRCm39) T427M probably benign Het
Wac A C 18: 7,926,131 (GRCm39) M596L possibly damaging Het
Zfhx2 G T 14: 55,302,014 (GRCm39) P1990Q probably damaging Het
Zfp853 T C 5: 143,275,332 (GRCm39) E96G unknown Het
Zzef1 G A 11: 72,801,152 (GRCm39) probably null Het
Other mutations in Ice2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Ice2 APN 9 69,323,395 (GRCm39) missense probably benign 0.04
IGL01626:Ice2 APN 9 69,314,614 (GRCm39) missense probably benign 0.39
IGL03035:Ice2 APN 9 69,332,970 (GRCm39) missense probably benign 0.06
R0227:Ice2 UTSW 9 69,319,510 (GRCm39) missense probably benign 0.08
R1373:Ice2 UTSW 9 69,314,401 (GRCm39) missense probably benign 0.01
R1381:Ice2 UTSW 9 69,307,809 (GRCm39) missense probably damaging 1.00
R1599:Ice2 UTSW 9 69,318,724 (GRCm39) missense probably null 0.01
R1778:Ice2 UTSW 9 69,322,930 (GRCm39) missense probably benign 0.04
R1818:Ice2 UTSW 9 69,339,383 (GRCm39) missense probably benign 0.00
R1829:Ice2 UTSW 9 69,314,635 (GRCm39) missense probably damaging 0.99
R1876:Ice2 UTSW 9 69,322,857 (GRCm39) missense possibly damaging 0.85
R1878:Ice2 UTSW 9 69,335,858 (GRCm39) critical splice donor site probably null
R2026:Ice2 UTSW 9 69,323,607 (GRCm39) missense probably benign 0.00
R4097:Ice2 UTSW 9 69,328,953 (GRCm39) missense possibly damaging 0.95
R4815:Ice2 UTSW 9 69,314,400 (GRCm39) missense probably damaging 1.00
R4861:Ice2 UTSW 9 69,322,730 (GRCm39) missense probably benign 0.00
R4861:Ice2 UTSW 9 69,322,730 (GRCm39) missense probably benign 0.00
R5066:Ice2 UTSW 9 69,315,573 (GRCm39) missense probably benign 0.00
R5653:Ice2 UTSW 9 69,335,662 (GRCm39) missense probably benign 0.00
R5898:Ice2 UTSW 9 69,315,544 (GRCm39) missense probably benign 0.08
R5951:Ice2 UTSW 9 69,319,651 (GRCm39) missense possibly damaging 0.67
R6176:Ice2 UTSW 9 69,324,354 (GRCm39) missense probably damaging 1.00
R6566:Ice2 UTSW 9 69,323,511 (GRCm39) missense probably benign
R6632:Ice2 UTSW 9 69,335,734 (GRCm39) missense probably benign 0.07
R7195:Ice2 UTSW 9 69,335,782 (GRCm39) missense possibly damaging 0.91
R7272:Ice2 UTSW 9 69,324,365 (GRCm39) missense possibly damaging 0.46
R7365:Ice2 UTSW 9 69,307,794 (GRCm39) missense probably damaging 1.00
R7495:Ice2 UTSW 9 69,323,511 (GRCm39) missense probably benign 0.01
R7535:Ice2 UTSW 9 69,339,360 (GRCm39) missense probably damaging 0.98
R7937:Ice2 UTSW 9 69,318,067 (GRCm39) missense possibly damaging 0.71
R8124:Ice2 UTSW 9 69,307,777 (GRCm39) missense probably damaging 1.00
R8381:Ice2 UTSW 9 69,317,453 (GRCm39) missense probably damaging 1.00
R8525:Ice2 UTSW 9 69,318,698 (GRCm39) missense probably damaging 1.00
R9586:Ice2 UTSW 9 69,314,478 (GRCm39) missense probably damaging 1.00
R9672:Ice2 UTSW 9 69,322,899 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGGAGGTTCTAAGATTGACATCTG -3'
(R):5'- TGTTAGAACAACCAGGATTCATGC -3'

Sequencing Primer
(F):5'- AGGGCAGTGCAAAGTTT -3'
(R):5'- GGCTGGTCTCAAACTCAGAAATTC -3'
Posted On 2014-12-29