Incidental Mutation 'R4892:Ttc29'
ID 377345
Institutional Source Beutler Lab
Gene Symbol Ttc29
Ensembl Gene ENSMUSG00000037101
Gene Name tetratricopeptide repeat domain 29
Synonyms 1700031F13Rik
MMRRC Submission 042497-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R4892 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 78213297-78394326 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78333645 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 398 (V398A)
Ref Sequence ENSEMBL: ENSMUSP00000105528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049395] [ENSMUST00000109902]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000049395
AA Change: V398A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041919
Gene: ENSMUSG00000037101
AA Change: V398A

DomainStartEndE-ValueType
low complexity region 189 199 N/A INTRINSIC
Blast:TPR 234 267 2e-7 BLAST
TPR 274 307 4.1e1 SMART
TPR 314 347 2.48e0 SMART
TPR 354 387 2.48e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109902
AA Change: V398A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105528
Gene: ENSMUSG00000037101
AA Change: V398A

DomainStartEndE-ValueType
low complexity region 189 199 N/A INTRINSIC
Blast:TPR 234 267 2e-7 BLAST
TPR 274 307 4.1e1 SMART
TPR 314 347 2.48e0 SMART
TPR 354 387 2.48e0 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,509,802 T1128A probably benign Het
Apol11a A T 15: 77,516,990 K226* probably null Het
Atp4a A G 7: 30,712,474 M45V probably benign Het
Babam1 T A 8: 71,403,052 M263K probably benign Het
Capn11 GACA GA 17: 45,633,097 probably null Het
Ccdc190 C A 1: 169,930,109 L46I possibly damaging Het
Cep131 C T 11: 120,068,057 R717H probably damaging Het
Cpt1c A G 7: 44,959,588 F770L probably benign Het
Dhx30 A T 9: 110,085,856 probably null Het
Dido1 G A 2: 180,675,029 Q662* probably null Het
Dip2a T C 10: 76,280,759 E910G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fmo3 T A 1: 162,968,731 I91F probably benign Het
Gdap1 A C 1: 17,159,994 D217A possibly damaging Het
Grm1 T C 10: 10,719,587 S766G possibly damaging Het
Kat8 T A 7: 127,915,538 I123N possibly damaging Het
Kcnt2 C A 1: 140,513,025 S23* probably null Het
Krt73 G A 15: 101,795,809 T432I probably damaging Het
Lgals9 T A 11: 78,966,083 I223L probably benign Het
Mpo T A 11: 87,802,681 N48K probably benign Het
Myo9a T G 9: 59,824,242 H632Q probably damaging Het
Olfr1386 C A 11: 49,470,216 Q22K probably benign Het
Olfr1412 A G 1: 92,588,921 N197S probably benign Het
Prelid2 A G 18: 41,951,144 F11S possibly damaging Het
Setd1a G T 7: 127,778,524 V57L probably damaging Het
Sgip1 A G 4: 102,966,234 D704G probably damaging Het
Spryd3 T C 15: 102,118,102 E378G probably benign Het
Stk17b A T 1: 53,771,611 Y112N probably damaging Het
Syndig1 A T 2: 149,899,891 K132N probably damaging Het
Tcf20 C T 15: 82,854,199 R1017Q possibly damaging Het
Tenm3 T A 8: 48,276,861 D1370V probably damaging Het
Tnrc6a C T 7: 123,169,911 T308I probably damaging Het
Ubr4 A G 4: 139,428,517 T2218A probably benign Het
Other mutations in Ttc29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Ttc29 APN 8 78333756 missense probably benign 0.13
IGL01785:Ttc29 APN 8 78282341 missense probably damaging 1.00
IGL02412:Ttc29 APN 8 78276940 missense possibly damaging 0.47
IGL03068:Ttc29 APN 8 78325551 missense probably benign 0.00
PIT4519001:Ttc29 UTSW 8 78325477 missense probably benign 0.04
R0523:Ttc29 UTSW 8 78276837 missense probably benign 0.01
R1214:Ttc29 UTSW 8 78325582 missense probably damaging 1.00
R1869:Ttc29 UTSW 8 78282385 missense probably benign
R1902:Ttc29 UTSW 8 78251732 missense probably benign 0.03
R1903:Ttc29 UTSW 8 78251732 missense probably benign 0.03
R4612:Ttc29 UTSW 8 78325546 missense probably benign 0.02
R4649:Ttc29 UTSW 8 78333579 missense probably benign 0.12
R5306:Ttc29 UTSW 8 78251910 critical splice donor site probably null
R5649:Ttc29 UTSW 8 78246313 missense possibly damaging 0.47
R5996:Ttc29 UTSW 8 78276896 missense probably damaging 0.99
R6036:Ttc29 UTSW 8 78325576 missense probably benign 0.03
R6036:Ttc29 UTSW 8 78325576 missense probably benign 0.03
R6495:Ttc29 UTSW 8 78282334 missense possibly damaging 0.79
R6813:Ttc29 UTSW 8 78333620 missense probably benign 0.01
R6961:Ttc29 UTSW 8 78276916 missense possibly damaging 0.77
R7686:Ttc29 UTSW 8 78393130 missense probably benign 0.15
R8714:Ttc29 UTSW 8 78333702 missense possibly damaging 0.85
R8962:Ttc29 UTSW 8 78315707 missense probably damaging 0.98
R9420:Ttc29 UTSW 8 78333761 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCCCCTTCTCACAGAAAG -3'
(R):5'- CTAAAGCGTTTCCGGAAGCC -3'

Sequencing Primer
(F):5'- ATGCTCCTCAGAAATGCGTG -3'
(R):5'- CGAAGCCTTACCTAGAATCGGGTC -3'
Posted On 2016-03-17