Incidental Mutation 'R4892:Prelid2'
ID377365
Institutional Source Beutler Lab
Gene Symbol Prelid2
Ensembl Gene ENSMUSG00000056671
Gene NamePRELI domain containing 2
SynonymsC330008K14Rik, 1700003A01Rik
MMRRC Submission 042497-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4892 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location41875696-41951194 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41951144 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 11 (F11S)
Ref Sequence ENSEMBL: ENSMUSP00000064661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070949]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070949
AA Change: F11S

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064661
Gene: ENSMUSG00000056671
AA Change: F11S

DomainStartEndE-ValueType
Pfam:PRELI 16 173 2.8e-51 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,509,802 T1128A probably benign Het
Apol11a A T 15: 77,516,990 K226* probably null Het
Atp4a A G 7: 30,712,474 M45V probably benign Het
Babam1 T A 8: 71,403,052 M263K probably benign Het
Capn11 GACA GA 17: 45,633,097 probably null Het
Ccdc190 C A 1: 169,930,109 L46I possibly damaging Het
Cep131 C T 11: 120,068,057 R717H probably damaging Het
Cpt1c A G 7: 44,959,588 F770L probably benign Het
Dhx30 A T 9: 110,085,856 probably null Het
Dido1 G A 2: 180,675,029 Q662* probably null Het
Dip2a T C 10: 76,280,759 E910G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fmo3 T A 1: 162,968,731 I91F probably benign Het
Gdap1 A C 1: 17,159,994 D217A possibly damaging Het
Grm1 T C 10: 10,719,587 S766G possibly damaging Het
Kat8 T A 7: 127,915,538 I123N possibly damaging Het
Kcnt2 C A 1: 140,513,025 S23* probably null Het
Krt73 G A 15: 101,795,809 T432I probably damaging Het
Lgals9 T A 11: 78,966,083 I223L probably benign Het
Mpo T A 11: 87,802,681 N48K probably benign Het
Myo9a T G 9: 59,824,242 H632Q probably damaging Het
Olfr1386 C A 11: 49,470,216 Q22K probably benign Het
Olfr1412 A G 1: 92,588,921 N197S probably benign Het
Setd1a G T 7: 127,778,524 V57L probably damaging Het
Sgip1 A G 4: 102,966,234 D704G probably damaging Het
Spryd3 T C 15: 102,118,102 E378G probably benign Het
Stk17b A T 1: 53,771,611 Y112N probably damaging Het
Syndig1 A T 2: 149,899,891 K132N probably damaging Het
Tcf20 C T 15: 82,854,199 R1017Q possibly damaging Het
Tenm3 T A 8: 48,276,861 D1370V probably damaging Het
Tnrc6a C T 7: 123,169,911 T308I probably damaging Het
Ttc29 T C 8: 78,333,645 V398A probably damaging Het
Ubr4 A G 4: 139,428,517 T2218A probably benign Het
Other mutations in Prelid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00709:Prelid2 APN 18 41912423 missense probably damaging 1.00
IGL01731:Prelid2 APN 18 41937649 missense probably benign 0.03
R0217:Prelid2 UTSW 18 41935252 splice site probably benign
R0556:Prelid2 UTSW 18 41951180 start gained probably benign
R0627:Prelid2 UTSW 18 41937652 missense possibly damaging 0.50
R0848:Prelid2 UTSW 18 41935224 missense probably damaging 0.98
R1522:Prelid2 UTSW 18 41881267 missense probably benign
R3919:Prelid2 UTSW 18 41937675 missense possibly damaging 0.79
R4131:Prelid2 UTSW 18 41951159 missense possibly damaging 0.94
R4422:Prelid2 UTSW 18 41912396 missense probably benign 0.01
R6062:Prelid2 UTSW 18 41912465 missense probably benign 0.00
R6725:Prelid2 UTSW 18 41912449 missense possibly damaging 0.82
R7276:Prelid2 UTSW 18 41912422 missense possibly damaging 0.65
R7739:Prelid2 UTSW 18 41912368 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCAGCTTTCGAGGAAAACC -3'
(R):5'- TGTGGGTGTGACCTATAGCC -3'

Sequencing Primer
(F):5'- GCTTTCGAGGAAAACCGCCTC -3'
(R):5'- ACCTATAGCCTTGTCTCGGAGGAG -3'
Posted On2016-03-17