Incidental Mutation 'R0304:Grip1'
ID37769
Institutional Source Beutler Lab
Gene Symbol Grip1
Ensembl Gene ENSMUSG00000034813
Gene Nameglutamate receptor interacting protein 1
Synonymseb
MMRRC Submission 038515-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0304 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location119453830-120087261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120075471 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 618 (S618N)
Ref Sequence ENSEMBL: ENSMUSP00000080016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041962] [ENSMUST00000077871] [ENSMUST00000081260] [ENSMUST00000105261] [ENSMUST00000105262] [ENSMUST00000130387] [ENSMUST00000138410] [ENSMUST00000144825] [ENSMUST00000144959] [ENSMUST00000147356] [ENSMUST00000147454] [ENSMUST00000148954] [ENSMUST00000154238]
Predicted Effect probably benign
Transcript: ENSMUST00000041962
AA Change: S1047N

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000042436
Gene: ENSMUSG00000034813
AA Change: S1047N

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 354 367 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
PDZ 429 509 6.36e-17 SMART
PDZ 530 606 1.11e-16 SMART
PDZ 629 703 1.73e-18 SMART
PDZ 947 1019 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077871
AA Change: S1020N

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000077033
Gene: ENSMUSG00000034813
AA Change: S1020N

DomainStartEndE-ValueType
PDZ 36 110 4.86e-13 SMART
PDZ 134 212 6.4e-22 SMART
PDZ 235 310 1.97e-13 SMART
low complexity region 327 340 N/A INTRINSIC
low complexity region 361 378 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
PDZ 402 482 6.36e-17 SMART
PDZ 503 579 1.11e-16 SMART
PDZ 602 676 1.73e-18 SMART
PDZ 920 992 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081260
AA Change: S618N

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080016
Gene: ENSMUSG00000034813
AA Change: S618N

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
PDZ 65 145 3e-19 SMART
PDZ 166 242 5.2e-19 SMART
PDZ 265 339 8.4e-21 SMART
PDZ 518 590 1.4e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105261
AA Change: S618N

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000100896
Gene: ENSMUSG00000034813
AA Change: S618N

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
PDZ 65 145 6.36e-17 SMART
PDZ 166 242 1.11e-16 SMART
PDZ 265 339 1.73e-18 SMART
PDZ 518 590 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105262
AA Change: S1046N

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000100897
Gene: ENSMUSG00000034813
AA Change: S1046N

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 353 366 N/A INTRINSIC
low complexity region 387 404 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
PDZ 428 508 6.36e-17 SMART
PDZ 529 605 1.11e-16 SMART
PDZ 628 702 1.73e-18 SMART
PDZ 946 1018 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127787
Predicted Effect probably benign
Transcript: ENSMUST00000130387
AA Change: S683N

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123288
Gene: ENSMUSG00000034813
AA Change: S683N

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
PDZ 65 145 6.36e-17 SMART
PDZ 166 242 1.11e-16 SMART
PDZ 265 339 1.73e-18 SMART
PDZ 583 655 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138410
AA Change: S1113N

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000123234
Gene: ENSMUSG00000034813
AA Change: S1113N

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 1013 1085 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139352
Predicted Effect probably benign
Transcript: ENSMUST00000144825
AA Change: S1019N

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000121670
Gene: ENSMUSG00000034813
AA Change: S1019N

DomainStartEndE-ValueType
PDZ 35 109 4.86e-13 SMART
PDZ 133 211 6.4e-22 SMART
PDZ 234 309 1.97e-13 SMART
low complexity region 326 339 N/A INTRINSIC
low complexity region 360 377 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
PDZ 401 481 6.36e-17 SMART
PDZ 502 578 1.11e-16 SMART
PDZ 601 675 1.73e-18 SMART
PDZ 919 991 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144959
AA Change: S1098N

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000122323
Gene: ENSMUSG00000034813
AA Change: S1098N

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147356
AA Change: S1099N

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000115478
Gene: ENSMUSG00000034813
AA Change: S1099N

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 394 422 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
PDZ 481 561 6.36e-17 SMART
PDZ 582 658 1.11e-16 SMART
PDZ 681 755 1.73e-18 SMART
PDZ 999 1071 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147454
AA Change: S1098N

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000118073
Gene: ENSMUSG00000034813
AA Change: S1098N

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148954
AA Change: S1061N

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000118397
Gene: ENSMUSG00000034813
AA Change: S1061N

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 353 366 N/A INTRINSIC
low complexity region 387 404 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
PDZ 428 508 6.36e-17 SMART
PDZ 529 605 1.11e-16 SMART
PDZ 628 702 1.73e-18 SMART
PDZ 961 1033 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154238
AA Change: S698N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122349
Gene: ENSMUSG00000034813
AA Change: S698N

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
PDZ 65 145 6.36e-17 SMART
PDZ 166 242 1.11e-16 SMART
PDZ 265 339 1.73e-18 SMART
PDZ 598 670 2.79e-13 SMART
Meta Mutation Damage Score 0.0661 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: This gene encodes a protein containing multiple PDZ (post synaptic density protein, Drosophila disc large tumor suppressor, and zonula occludens-1 protein) domains. The encoded protein acts as a mediator between cytoskeletal and membrane proteins, particularly in neuronal cells, and facilitates complex formation at the cell membrane. Mutation of this gene can cause embryonic lethality resulting from defects of the dermo-epidermal junction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous ablation of gene function results in embryonic lethality and blistering skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik C T 4: 144,520,049 T55I probably benign Het
Acod1 T A 14: 103,054,982 I314N probably damaging Het
Actl11 T A 9: 107,929,768 V430E probably damaging Het
Adam19 A C 11: 46,127,392 D427A possibly damaging Het
Adarb2 C T 13: 8,752,570 probably benign Het
Akap7 A T 10: 25,271,552 H93Q probably damaging Het
Ankrd36 C A 11: 5,628,981 R82S possibly damaging Het
Arhgap21 A T 2: 20,859,801 probably benign Het
Atm T A 9: 53,516,344 I489F probably benign Het
AU019823 T C 9: 50,607,922 D130G probably damaging Het
Carmil1 T C 13: 24,139,341 S243G probably damaging Het
Cdc42bpg T C 19: 6,317,248 V939A probably damaging Het
Cel A C 2: 28,557,771 L377R probably benign Het
Clock A G 5: 76,226,985 V779A unknown Het
Cluap1 G A 16: 3,929,918 probably benign Het
Ctif A T 18: 75,521,818 H212Q probably benign Het
Cyp4a29 T A 4: 115,252,932 probably benign Het
Cytip T C 2: 58,148,246 N101S possibly damaging Het
D130043K22Rik T C 13: 24,864,815 M434T probably benign Het
Ddx47 A G 6: 135,017,220 I154V possibly damaging Het
Dnah6 C T 6: 73,159,115 E1014K probably damaging Het
Dnajc27 T G 12: 4,106,793 probably benign Het
Drc7 A T 8: 95,059,128 D204V probably damaging Het
Dsc3 A G 18: 19,981,241 Y319H probably damaging Het
Eml6 T C 11: 29,777,441 Q1227R probably benign Het
Enpp2 A T 15: 54,877,806 D365E probably benign Het
Ercc2 T C 7: 19,386,708 I199T possibly damaging Het
Exd2 G A 12: 80,491,240 probably benign Het
F2 A T 2: 91,633,233 I128N probably damaging Het
Fam219b T C 9: 57,538,876 L123P probably damaging Het
Fasn A G 11: 120,819,936 V299A possibly damaging Het
Fastkd2 T C 1: 63,752,400 V689A possibly damaging Het
Fbxw13 C T 9: 109,194,721 R85Q probably benign Het
Fer1l6 A G 15: 58,590,562 Y822C probably benign Het
Fhl5 T C 4: 25,207,241 T176A probably benign Het
Gm20530 T G 17: 36,094,226 noncoding transcript Het
Gm4787 A T 12: 81,378,934 I150N probably damaging Het
Hdac9 T C 12: 34,374,111 K454E probably damaging Het
Iars2 T A 1: 185,287,156 I978F possibly damaging Het
Icosl A G 10: 78,075,322 Y299C probably benign Het
Idi1 T C 13: 8,890,357 Y192H probably damaging Het
Iqub T G 6: 24,454,291 Q531P probably damaging Het
Itih4 T A 14: 30,890,094 probably null Het
Izumo4 A T 10: 80,702,936 H71L probably damaging Het
Jcad A T 18: 4,673,325 E362D possibly damaging Het
Kif21a G T 15: 90,976,521 probably null Het
Kynu A T 2: 43,679,881 I392F probably damaging Het
Luc7l2 A G 6: 38,592,776 E223G probably damaging Het
Map3k8 A C 18: 4,339,552 L273R probably damaging Het
Max A G 12: 76,938,587 L119P probably benign Het
Mphosph9 T C 5: 124,298,829 N484S probably benign Het
Mrgprg A G 7: 143,765,055 Y107H probably damaging Het
Mrps31 A T 8: 22,421,338 I199F probably benign Het
Mtr C G 13: 12,222,154 probably null Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nptx2 A G 5: 144,553,650 probably benign Het
Nrip1 T C 16: 76,292,707 Q654R possibly damaging Het
Ocm A G 5: 144,024,534 F30L probably damaging Het
Olfr1216 G A 2: 89,013,288 R259W probably damaging Het
Olfr1223 A C 2: 89,144,764 Y86* probably null Het
Olfr297 C T 7: 86,526,987 P77S probably damaging Het
Olfr600 G T 7: 103,346,711 D72E probably damaging Het
Oosp1 T C 19: 11,690,969 M17V probably benign Het
Pax1 A T 2: 147,366,147 Y225F probably benign Het
Pde4dip T A 3: 97,843,712 H62L probably benign Het
Pkd1 C A 17: 24,585,946 Q3190K probably damaging Het
Pkn1 A C 8: 83,683,607 probably benign Het
Plin5 T C 17: 56,115,597 D113G probably damaging Het
Ppfia1 A G 7: 144,482,345 V1141A probably damaging Het
Ppp4r1 T A 17: 65,816,006 D334E probably benign Het
Ptov1 A T 7: 44,863,449 probably null Het
Rab22a G A 2: 173,661,459 V22M probably damaging Het
Rictor T A 15: 6,786,371 probably null Het
Sart1 G T 19: 5,380,531 probably benign Het
Scn11a G A 9: 119,819,862 A45V probably benign Het
Serpina5 A G 12: 104,103,200 T224A possibly damaging Het
Siglecf G T 7: 43,352,401 G212C probably damaging Het
Slc38a4 A T 15: 97,008,454 M378K probably damaging Het
Spata22 T A 11: 73,340,449 C176* probably null Het
Tmc3 G A 7: 83,596,139 E131K probably damaging Het
Trappc10 A T 10: 78,210,760 probably benign Het
Uvrag A G 7: 98,887,973 F672L probably benign Het
Vmn1r121 A G 7: 21,098,407 V36A possibly damaging Het
Vmn1r13 A T 6: 57,210,626 M257L probably benign Het
Vmn1r58 C T 7: 5,410,496 C245Y probably damaging Het
Vmn1r86 C A 7: 13,102,780 M56I probably benign Het
Wdr62 T C 7: 30,242,874 Y1051C probably benign Het
Xpnpep3 A G 15: 81,430,714 D205G probably damaging Het
Zdhhc14 T C 17: 5,725,336 probably benign Het
Zfp607a A T 7: 27,879,212 D569V possibly damaging Het
Zfp609 C T 9: 65,701,188 E1137K possibly damaging Het
Zfp871 T C 17: 32,774,434 Y589C probably damaging Het
Zzef1 A T 11: 72,880,624 D1644V probably benign Het
Other mutations in Grip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Grip1 APN 10 119931302 nonsense probably null
IGL01374:Grip1 APN 10 120049368 missense probably benign 0.03
IGL01592:Grip1 APN 10 119930003 missense probably damaging 1.00
IGL02207:Grip1 APN 10 120075309 missense probably damaging 1.00
IGL02222:Grip1 APN 10 119999809 missense probably damaging 1.00
IGL02225:Grip1 APN 10 120049453 missense probably damaging 1.00
IGL02447:Grip1 APN 10 120020071 missense probably damaging 1.00
IGL02492:Grip1 APN 10 119930040 splice site probably benign
IGL02522:Grip1 APN 10 119931249 missense probably damaging 1.00
IGL02574:Grip1 APN 10 119942913 missense probably damaging 1.00
IGL02718:Grip1 APN 10 120075515 makesense probably null
IGL02751:Grip1 APN 10 119978577 missense probably benign 0.08
IGL03221:Grip1 APN 10 119986394 missense probably benign 0.00
IGL03377:Grip1 APN 10 120055032 missense probably damaging 0.98
PIT4403001:Grip1 UTSW 10 119929928 missense probably damaging 1.00
R0681:Grip1 UTSW 10 120010230 missense probably damaging 1.00
R0760:Grip1 UTSW 10 120018078 missense probably damaging 0.96
R1457:Grip1 UTSW 10 119986350 missense possibly damaging 0.73
R1506:Grip1 UTSW 10 119978451 missense probably damaging 1.00
R1541:Grip1 UTSW 10 120000543 missense probably damaging 0.99
R1553:Grip1 UTSW 10 120054851 missense probably damaging 1.00
R1709:Grip1 UTSW 10 119897715 missense probably damaging 0.98
R2055:Grip1 UTSW 10 120049511 splice site probably benign
R2059:Grip1 UTSW 10 120038698 missense possibly damaging 0.80
R2261:Grip1 UTSW 10 119985584 missense probably benign 0.00
R2475:Grip1 UTSW 10 119978496 missense probably benign 0.01
R3777:Grip1 UTSW 10 119985630 critical splice donor site probably null
R3849:Grip1 UTSW 10 119929958 missense probably damaging 1.00
R3956:Grip1 UTSW 10 119930026 missense probably damaging 1.00
R4643:Grip1 UTSW 10 120020101 missense probably damaging 1.00
R4693:Grip1 UTSW 10 120000554 missense probably benign 0.10
R4724:Grip1 UTSW 10 120038683 missense probably benign 0.02
R4843:Grip1 UTSW 10 119930015 missense probably damaging 1.00
R4884:Grip1 UTSW 10 120075306 missense probably damaging 1.00
R4912:Grip1 UTSW 10 119931248 missense probably damaging 1.00
R5185:Grip1 UTSW 10 119931259 missense probably benign 0.37
R5291:Grip1 UTSW 10 120086969 missense probably benign 0.04
R5293:Grip1 UTSW 10 119897735 missense probably damaging 0.99
R5296:Grip1 UTSW 10 119929928 missense probably damaging 1.00
R5302:Grip1 UTSW 10 120020077 missense probably damaging 1.00
R5541:Grip1 UTSW 10 120072718 missense probably damaging 1.00
R5792:Grip1 UTSW 10 119985480 missense probably benign 0.07
R5861:Grip1 UTSW 10 119929970 missense probably damaging 1.00
R5905:Grip1 UTSW 10 119985492 missense probably benign 0.02
R5949:Grip1 UTSW 10 120050242 missense probably benign 0.00
R6112:Grip1 UTSW 10 119993232 missense probably benign 0.00
R6166:Grip1 UTSW 10 120072718 missense probably damaging 1.00
R6167:Grip1 UTSW 10 119897797 critical splice donor site probably null
R6193:Grip1 UTSW 10 120038314 missense probably damaging 1.00
R6218:Grip1 UTSW 10 119986346 missense possibly damaging 0.95
R6267:Grip1 UTSW 10 120075464 nonsense probably null
R6296:Grip1 UTSW 10 120075464 nonsense probably null
R6490:Grip1 UTSW 10 119986424 missense possibly damaging 0.82
R6543:Grip1 UTSW 10 119985594 missense probably benign 0.00
R6558:Grip1 UTSW 10 119454383 missense probably benign 0.00
R6995:Grip1 UTSW 10 119986470 missense probably damaging 0.99
R7122:Grip1 UTSW 10 120035374 missense possibly damaging 0.48
R7157:Grip1 UTSW 10 119945156 missense probably damaging 1.00
R7410:Grip1 UTSW 10 120020020 missense probably benign 0.01
R7447:Grip1 UTSW 10 120086966 missense probably benign 0.01
R7539:Grip1 UTSW 10 120054871 missense probably benign 0.17
R7586:Grip1 UTSW 10 120077138 splice site probably null
R7768:Grip1 UTSW 10 120038397 missense probably damaging 0.98
R7831:Grip1 UTSW 10 120018106 missense probably damaging 1.00
R7896:Grip1 UTSW 10 119978545 missense possibly damaging 0.53
R7914:Grip1 UTSW 10 120018106 missense probably damaging 1.00
R7979:Grip1 UTSW 10 119978545 missense possibly damaging 0.53
RF011:Grip1 UTSW 10 119931315 missense probably null 0.97
Z1176:Grip1 UTSW 10 119819483 unclassified probably benign
Z1177:Grip1 UTSW 10 119986444 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACGAGAGACTTTGACTGCTGCCTG -3'
(R):5'- AAGCCTAATGCTATACCTGCGCC -3'

Sequencing Primer
(F):5'- CCTGGTGGTGCCTCTCATAG -3'
(R):5'- GATTTAAAAGACCCCTGTGCTTGC -3'
Posted On2013-05-23