Incidental Mutation 'R4464:Fam213a'
ID377809
Institutional Source Beutler Lab
Gene Symbol Fam213a
Ensembl Gene ENSMUSG00000021792
Gene Namefamily with sequence similarity 213, member A
Synonyms
MMRRC Submission 041722-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R4464 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location40993740-41013788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40997875 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 127 (K127N)
Ref Sequence ENSEMBL: ENSMUSP00000121795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022317] [ENSMUST00000118466] [ENSMUST00000128236] [ENSMUST00000130166] [ENSMUST00000134715] [ENSMUST00000136661] [ENSMUST00000143143] [ENSMUST00000153830]
Predicted Effect probably damaging
Transcript: ENSMUST00000022317
AA Change: K127N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022317
Gene: ENSMUSG00000021792
AA Change: K127N

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:AhpC-TSA 37 130 1.1e-6 PFAM
Pfam:AhpC-TSA_2 83 191 3.2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118466
AA Change: K138N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112377
Gene: ENSMUSG00000021792
AA Change: K138N

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:AhpC-TSA 48 141 6.6e-7 PFAM
Pfam:AhpC-TSA_2 94 202 5.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128236
SMART Domains Protein: ENSMUSP00000120052
Gene: ENSMUSG00000021792

DomainStartEndE-ValueType
transmembrane domain 4 21 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130166
AA Change: K127N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122866
Gene: ENSMUSG00000021792
AA Change: K127N

DomainStartEndE-ValueType
transmembrane domain 4 21 N/A INTRINSIC
Pfam:AhpC-TSA 37 130 6.2e-7 PFAM
Pfam:AhpC-TSA_2 83 176 2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134715
SMART Domains Protein: ENSMUSP00000115439
Gene: ENSMUSG00000021792

DomainStartEndE-ValueType
transmembrane domain 4 21 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135797
Predicted Effect probably damaging
Transcript: ENSMUST00000136661
AA Change: K127N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121795
Gene: ENSMUSG00000021792
AA Change: K127N

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:AhpC-TSA 37 130 8.6e-7 PFAM
Pfam:AhpC-TSA_2 83 191 3.7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143143
AA Change: K127N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115839
Gene: ENSMUSG00000021792
AA Change: K127N

DomainStartEndE-ValueType
transmembrane domain 4 21 N/A INTRINSIC
Pfam:AhpC-TSA 37 130 6.1e-7 PFAM
Pfam:AhpC-TSA_2 83 175 5.6e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153830
AA Change: K138N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117278
Gene: ENSMUSG00000021792
AA Change: K138N

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:AhpC-TSA_2 94 202 5e-18 PFAM
Meta Mutation Damage Score 0.3700 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (35/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced circulating adipokine levels and decreased collagen deposition in adipose tissue along with mild adipocyte ER stress and hyperinsulinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc3 A G 11: 94,358,786 V1111A probably benign Het
Acot10 G A 15: 20,665,744 R304* probably null Het
Aldh8a1 C A 10: 21,388,941 probably benign Het
Alms1 A G 6: 85,620,021 T1079A possibly damaging Het
Armc3 T C 2: 19,248,659 Y204H probably damaging Het
Asnsd1 C A 1: 53,352,527 probably null Het
Atad5 T A 11: 80,100,311 probably null Het
Cst12 G A 2: 148,789,517 V53I possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dennd1a A T 2: 38,243,390 probably benign Het
Gm7535 C A 17: 17,911,662 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ifngr1 G A 10: 19,597,517 V72I possibly damaging Het
Kifap3 C A 1: 163,817,895 Q269K probably benign Het
Krt86 G A 15: 101,473,914 D122N probably damaging Het
Lrrcc1 A G 3: 14,557,318 K694E probably damaging Het
Mbd4 A G 6: 115,849,502 L155S probably damaging Het
Nalcn T C 14: 123,323,350 N772D probably benign Het
Olfr109 C T 17: 37,466,851 S215F probably damaging Het
Psg29 A T 7: 17,210,650 N362Y possibly damaging Het
Ptpn23 G A 9: 110,386,813 T1325I probably damaging Het
Rad51ap1 T C 6: 126,934,768 N52S possibly damaging Het
Rb1 C A 14: 73,199,198 probably null Het
Slc34a2 T C 5: 53,069,182 L490P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
St3gal2 A G 8: 110,967,502 N207D probably benign Het
Stat1 T G 1: 52,137,416 D257E possibly damaging Het
Tkt A G 14: 30,568,274 T165A possibly damaging Het
Trim66 A T 7: 109,477,690 S347R possibly damaging Het
Zfp429 T C 13: 67,390,498 I276V probably benign Het
Other mutations in Fam213a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5549:Fam213a UTSW 14 41004056 missense possibly damaging 0.83
R5742:Fam213a UTSW 14 41002503 missense possibly damaging 0.86
R6761:Fam213a UTSW 14 40994621 missense probably damaging 0.99
R7014:Fam213a UTSW 14 41002494 missense probably benign 0.00
R7206:Fam213a UTSW 14 41004185 missense probably benign 0.00
R8000:Fam213a UTSW 14 40994526 makesense not run
Predicted Primers PCR Primer
(F):5'- TGTAGAGATTCAGTCTGGGGCC -3'
(R):5'- AGCTTTCTGTTTCCCTAGGCAG -3'

Sequencing Primer
(F):5'- CCCATGGGTCTGAAGTCAATACTG -3'
(R):5'- CCCTAGGCAGTTGAGTATGATCC -3'
Posted On2016-04-07