Incidental Mutation 'R4464:Cylc2'
ID330265
Institutional Source Beutler Lab
Gene Symbol Cylc2
Ensembl Gene ENSMUSG00000039555
Gene Namecylicin, basic protein of sperm head cytoskeleton 2
Synonyms4930488P18Rik
MMRRC Submission 041722-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R4464 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location51216678-51230272 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 51229651 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 331 (T331R)
Ref Sequence ENSEMBL: ENSMUSP00000125758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041392] [ENSMUST00000166749]
Predicted Effect unknown
Transcript: ENSMUST00000041392
AA Change: T331R
SMART Domains Protein: ENSMUSP00000039750
Gene: ENSMUSG00000039555
AA Change: T331R

DomainStartEndE-ValueType
Pfam:Cylicin_N 7 115 1.1e-43 PFAM
low complexity region 122 131 N/A INTRINSIC
low complexity region 174 220 N/A INTRINSIC
low complexity region 224 245 N/A INTRINSIC
low complexity region 249 272 N/A INTRINSIC
low complexity region 278 300 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156384
Predicted Effect unknown
Transcript: ENSMUST00000166749
AA Change: T331R
SMART Domains Protein: ENSMUSP00000125758
Gene: ENSMUSG00000039555
AA Change: T331R

DomainStartEndE-ValueType
Pfam:Cylicin_N 8 113 4.6e-46 PFAM
low complexity region 122 131 N/A INTRINSIC
low complexity region 174 220 N/A INTRINSIC
low complexity region 224 245 N/A INTRINSIC
low complexity region 249 272 N/A INTRINSIC
low complexity region 278 300 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
low complexity region 338 420 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc3 A G 11: 94,358,786 V1111A probably benign Het
Acot10 G A 15: 20,665,744 R304* probably null Het
Aldh8a1 C A 10: 21,388,941 probably benign Het
Alms1 A G 6: 85,620,021 T1079A possibly damaging Het
Armc3 T C 2: 19,248,659 Y204H probably damaging Het
Asnsd1 C A 1: 53,352,527 probably null Het
Atad5 T A 11: 80,100,311 probably null Het
Cst12 G A 2: 148,789,517 V53I possibly damaging Het
Dennd1a A T 2: 38,243,390 probably benign Het
Fam213a T A 14: 40,997,875 K127N probably damaging Het
Gm7535 C A 17: 17,911,662 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ifngr1 G A 10: 19,597,517 V72I possibly damaging Het
Kifap3 C A 1: 163,817,895 Q269K probably benign Het
Krt86 G A 15: 101,473,914 D122N probably damaging Het
Lrrcc1 A G 3: 14,557,318 K694E probably damaging Het
Mbd4 A G 6: 115,849,502 L155S probably damaging Het
Nalcn T C 14: 123,323,350 N772D probably benign Het
Olfr109 C T 17: 37,466,851 S215F probably damaging Het
Psg29 A T 7: 17,210,650 N362Y possibly damaging Het
Ptpn23 G A 9: 110,386,813 T1325I probably damaging Het
Rad51ap1 T C 6: 126,934,768 N52S possibly damaging Het
Rb1 C A 14: 73,199,198 probably null Het
Slc34a2 T C 5: 53,069,182 L490P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
St3gal2 A G 8: 110,967,502 N207D probably benign Het
Stat1 T G 1: 52,137,416 D257E possibly damaging Het
Tkt A G 14: 30,568,274 T165A possibly damaging Het
Trim66 A T 7: 109,477,690 S347R possibly damaging Het
Zfp429 T C 13: 67,390,498 I276V probably benign Het
Other mutations in Cylc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Cylc2 APN 4 51228157 missense probably damaging 1.00
IGL01669:Cylc2 APN 4 51228360 missense probably benign 0.01
IGL02662:Cylc2 APN 4 51216698 utr 5 prime probably benign
R0277:Cylc2 UTSW 4 51228477 missense unknown
R0323:Cylc2 UTSW 4 51228477 missense unknown
R0968:Cylc2 UTSW 4 51216706 start codon destroyed probably null 0.50
R1395:Cylc2 UTSW 4 51228366 missense possibly damaging 0.53
R1639:Cylc2 UTSW 4 51228310 missense probably benign 0.23
R1643:Cylc2 UTSW 4 51225173 missense probably benign 0.38
R2829:Cylc2 UTSW 4 51229798 missense unknown
R4467:Cylc2 UTSW 4 51229651 missense unknown
R4496:Cylc2 UTSW 4 51229651 missense unknown
R4505:Cylc2 UTSW 4 51229651 missense unknown
R4514:Cylc2 UTSW 4 51229651 missense unknown
R4546:Cylc2 UTSW 4 51229651 missense unknown
R4546:Cylc2 UTSW 4 51229840 missense unknown
R4654:Cylc2 UTSW 4 51228279 missense probably benign 0.00
R4949:Cylc2 UTSW 4 51229804 missense unknown
R5141:Cylc2 UTSW 4 51228587 intron probably benign
R5176:Cylc2 UTSW 4 51228587 intron probably benign
R5177:Cylc2 UTSW 4 51228587 intron probably benign
R5179:Cylc2 UTSW 4 51228587 intron probably benign
R7508:Cylc2 UTSW 4 51229256 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCAGCCACAGAATCTGGAGG -3'
(R):5'- TTGAACCAAGACCTACTTCTCC -3'

Sequencing Primer
(F):5'- ATCTGGAGGTGAAAAGGCTGGTTC -3'
(R):5'- AACCAAGACCTACTTCTCCTACTTTG -3'
Posted On2015-07-21