Incidental Mutation 'R0244:Fastk'
ID 37958
Institutional Source Beutler Lab
Gene Symbol Fastk
Ensembl Gene ENSMUSG00000028959
Gene Name Fas-activated serine/threonine kinase
Synonyms
MMRRC Submission 038482-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0244 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 24438440-24445287 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 24442178 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030799] [ENSMUST00000030800] [ENSMUST00000080067] [ENSMUST00000115033] [ENSMUST00000115036] [ENSMUST00000115041] [ENSMUST00000115043] [ENSMUST00000115047] [ENSMUST00000115049] [ENSMUST00000123167] [ENSMUST00000144389] [ENSMUST00000127194]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000030799
SMART Domains Protein: ENSMUSP00000030799
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030800
SMART Domains Protein: ENSMUSP00000030800
Gene: ENSMUSG00000028959

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
Pfam:FAST_1 274 340 7.4e-18 PFAM
Pfam:FAST_2 351 440 5e-20 PFAM
RAP 475 532 3.04e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080067
SMART Domains Protein: ENSMUSP00000078972
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 93 110 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
low complexity region 138 151 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 296 313 N/A INTRINSIC
Pfam:Band_3_cyto 348 616 4.7e-111 PFAM
Pfam:HCO3_cotransp 671 1165 1.7e-217 PFAM
transmembrane domain 1183 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115033
SMART Domains Protein: ENSMUSP00000110685
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115036
SMART Domains Protein: ENSMUSP00000110688
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
transmembrane domain 26 45 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
UBQ 117 186 4.58e-4 SMART
low complexity region 190 206 N/A INTRINSIC
transmembrane domain 207 229 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115041
SMART Domains Protein: ENSMUSP00000110693
Gene: ENSMUSG00000028959

DomainStartEndE-ValueType
low complexity region 43 57 N/A INTRINSIC
low complexity region 101 112 N/A INTRINSIC
Pfam:FAST_1 136 204 5.4e-24 PFAM
Pfam:FAST_2 212 303 4.7e-26 PFAM
RAP 338 395 3.04e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115043
SMART Domains Protein: ENSMUSP00000110695
Gene: ENSMUSG00000028959

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
Pfam:FAST_1 273 341 7.6e-24 PFAM
Pfam:FAST_2 349 440 6.9e-26 PFAM
Pfam:RAP 475 513 1.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115047
SMART Domains Protein: ENSMUSP00000110699
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 79 96 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
low complexity region 124 137 N/A INTRINSIC
low complexity region 155 164 N/A INTRINSIC
low complexity region 186 202 N/A INTRINSIC
low complexity region 282 299 N/A INTRINSIC
Pfam:Band_3_cyto 334 602 7.2e-108 PFAM
Pfam:HCO3_cotransp 656 1151 1e-244 PFAM
transmembrane domain 1169 1186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115049
SMART Domains Protein: ENSMUSP00000110701
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 84 101 N/A INTRINSIC
low complexity region 103 126 N/A INTRINSIC
low complexity region 129 142 N/A INTRINSIC
low complexity region 160 169 N/A INTRINSIC
low complexity region 191 207 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
Pfam:Band_3_cyto 339 607 7.3e-108 PFAM
Pfam:HCO3_cotransp 661 1156 1e-244 PFAM
transmembrane domain 1174 1191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123144
Predicted Effect probably benign
Transcript: ENSMUST00000123167
SMART Domains Protein: ENSMUSP00000122487
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
Blast:UBQ 102 122 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149537
Predicted Effect probably benign
Transcript: ENSMUST00000144389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151900
Predicted Effect probably benign
Transcript: ENSMUST00000127194
SMART Domains Protein: ENSMUSP00000123173
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
low complexity region 175 204 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase was shown to be activated rapidly during Fas-mediated apoptosis in Jurkat cells. In response to Fas receptor ligation, it phosphorylates TIA1, an apoptosis-promoting nuclear RNA-binding protein. The encoded protein is a strong inducer of lymphocyte apoptosis. Two transcript variants encoding different isoforms have been found for this gene. Other variants exist, but their full-length natures have not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele lack neutophil infiltration in a model of house dust mite induced allergic pulmonary inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,286,491 probably null Het
Adamdec1 A T 14: 68,568,723 C434* probably null Het
Adprhl1 A G 8: 13,242,391 probably benign Het
Ago1 T A 4: 126,463,706 I59F possibly damaging Het
Arel1 T C 12: 84,920,693 T786A probably damaging Het
Arhgap26 A G 18: 39,363,131 K117R probably benign Het
Atp6v0b C T 4: 117,884,622 G204D probably damaging Het
Bace2 T A 16: 97,436,773 probably null Het
Camk4 G A 18: 33,179,625 probably null Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cep152 T C 2: 125,564,214 E1466G probably benign Het
Ces3b T C 8: 105,092,635 F441S probably damaging Het
Cfap52 T C 11: 67,926,382 T562A possibly damaging Het
Clca3a2 C A 3: 144,813,898 M238I possibly damaging Het
Cntnap5c A T 17: 58,102,168 D467V probably damaging Het
Col7a1 T A 9: 108,972,184 probably null Het
Cstf1 A G 2: 172,377,710 N247S possibly damaging Het
Dffb G T 4: 153,974,615 N68K probably benign Het
Duox2 C T 2: 122,291,860 G595S probably benign Het
Eftud2 T A 11: 102,864,725 I228F probably damaging Het
Elmo3 T C 8: 105,309,171 V578A probably benign Het
Elp2 A G 18: 24,631,471 D625G possibly damaging Het
Ep300 C T 15: 81,640,128 P1386S unknown Het
Fam120b A G 17: 15,417,637 D610G probably damaging Het
Fbxl6 A G 15: 76,537,191 S252P probably damaging Het
Fbxo43 T C 15: 36,161,793 K423E probably damaging Het
Filip1 T A 9: 79,819,462 E625V possibly damaging Het
Fkbp9 T A 6: 56,856,378 Y283* probably null Het
Gigyf2 T A 1: 87,379,015 D142E possibly damaging Het
Gm10142 T C 10: 77,716,014 probably null Het
Golga5 T C 12: 102,476,188 V262A probably benign Het
Hectd4 T C 5: 121,329,605 V2539A probably benign Het
Ica1 G T 6: 8,653,632 S335* probably null Het
Itga1 A T 13: 115,006,897 probably benign Het
Itgb1 T C 8: 128,717,685 probably benign Het
Itpr1 G A 6: 108,473,589 V1960I probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kprp C T 3: 92,825,411 V111I probably benign Het
Lamc3 T C 2: 31,940,721 I1490T probably damaging Het
Lcp1 A T 14: 75,227,001 D554V possibly damaging Het
Lgi3 A G 14: 70,534,698 T228A probably benign Het
Lipa A T 19: 34,501,541 F260I probably damaging Het
Lrriq1 C T 10: 103,215,773 E373K probably damaging Het
Map6 G A 7: 99,336,836 G649D probably benign Het
Mccc1 A G 3: 35,990,047 probably null Het
Mical3 A T 6: 120,957,722 S1799T probably benign Het
Mmp23 T A 4: 155,652,132 T151S probably damaging Het
Myo1d T A 11: 80,674,708 N401I probably damaging Het
Myo9b T A 8: 71,321,813 S323T probably damaging Het
Nbn G T 4: 15,979,353 W446L probably benign Het
Nedd1 A T 10: 92,716,265 probably benign Het
Ngef C A 1: 87,487,962 probably benign Het
Nup153 A T 13: 46,693,936 N672K probably benign Het
Olfr1308 T C 2: 111,961,016 N19S probably benign Het
Olfr149 T A 9: 39,702,173 I199F probably damaging Het
Olfr1509 T C 14: 52,450,512 V33A probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Palm2 T G 4: 57,710,177 V374G possibly damaging Het
Pdlim3 C A 8: 45,908,460 probably benign Het
Pmfbp1 G A 8: 109,541,673 E951K probably damaging Het
Pop1 T A 15: 34,515,891 C548* probably null Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ptpdc1 A T 13: 48,585,980 N658K probably benign Het
Ptprk A C 10: 28,206,225 E63D possibly damaging Het
Rtf1 C T 2: 119,732,877 R712W probably damaging Het
Samd7 A C 3: 30,751,073 T2P probably benign Het
Sft2d1 A G 17: 8,319,422 T52A probably benign Het
Slc25a26 A G 6: 94,510,833 H91R probably damaging Het
Slc5a4a A G 10: 76,189,152 E621G possibly damaging Het
Slf1 A T 13: 77,126,632 L28* probably null Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sorcs2 G A 5: 36,397,553 probably benign Het
Tacc2 T C 7: 130,751,825 probably benign Het
Tas2r140 A G 6: 133,055,327 V156A possibly damaging Het
Terf2ip C A 8: 112,018,164 T371K possibly damaging Het
Tifa C T 3: 127,796,888 L103F probably damaging Het
Tmco3 A G 8: 13,292,037 N104D probably damaging Het
Tmem259 T A 10: 79,978,963 D240V probably damaging Het
Trim60 C T 8: 65,001,048 R183H probably benign Het
Trps1 T C 15: 50,664,743 N725D probably damaging Het
Ttn C T 2: 76,814,806 V12902M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Unc79 A G 12: 103,112,891 K1772E probably damaging Het
Vwde C T 6: 13,193,126 V405I probably benign Het
Wdr18 T A 10: 79,966,408 D290E probably damaging Het
Wdr92 T C 11: 17,229,851 L284P probably damaging Het
Wwc2 G A 8: 47,900,721 A126V probably benign Het
Zfp882 A T 8: 71,913,523 I105F possibly damaging Het
Zfp942 A T 17: 21,928,572 C359S probably benign Het
Other mutations in Fastk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02149:Fastk APN 5 24444053 missense probably damaging 0.99
IGL02313:Fastk APN 5 24443092 missense probably damaging 1.00
IGL02374:Fastk APN 5 24444249 missense possibly damaging 0.48
R0733:Fastk UTSW 5 24443923 missense probably null 0.61
R1181:Fastk UTSW 5 24441731 critical splice donor site probably null
R1558:Fastk UTSW 5 24444047 splice site probably null
R1735:Fastk UTSW 5 24441803 missense probably damaging 1.00
R1815:Fastk UTSW 5 24441531 missense probably damaging 1.00
R2134:Fastk UTSW 5 24445141 missense probably damaging 0.99
R3934:Fastk UTSW 5 24442259 nonsense probably null
R4608:Fastk UTSW 5 24443119 missense probably damaging 1.00
R6671:Fastk UTSW 5 24441609 missense probably damaging 0.99
R8163:Fastk UTSW 5 24444275 missense probably benign 0.07
R8947:Fastk UTSW 5 24441651 missense probably damaging 0.97
R9245:Fastk UTSW 5 24444174 missense probably benign 0.00
R9575:Fastk UTSW 5 24445069 missense probably benign
X0022:Fastk UTSW 5 24444278 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCCACAGCCGTATCGAGTAGAGAG -3'
(R):5'- AGCGGAGTTTCCTGCTGGATAATG -3'

Sequencing Primer
(F):5'- GAGGTAGCGTCGCACAATC -3'
(R):5'- AGGTTGAACTACATGCCCCTG -3'
Posted On 2013-05-23