Mutagenetix > Incidental Mutation

Incidental Mutation 'R0244:Duox2'

37942

Institutional Source

Beutler Lab

Gene Symbol

Duox2

Ensembl Gene

ENSMUSG00000068452

Gene Name

dual oxidase 2

Synonyms

A430065P05Rik

MMRRC Submission

038482-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0244 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122279247-122298165 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 122291860 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 595 (G595S)

Ref Sequence

ENSEMBL: ENSMUSP00000050314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053734]

AlphaFold

A0A494BAW1

Predicted Effect

probably benign
Transcript: ENSMUST00000053734
AA Change: G595S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000050314
Gene: ENSMUSG00000068452
AA Change: G595S

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:An_peroxidase	35	560	5e-131	PFAM
transmembrane domain	600	622	N/A	INTRINSIC
EFh	823	851	3.7e-5	SMART
EFh	859	887	2.09e-4	SMART
transmembrane domain	1010	1032	N/A	INTRINSIC
Pfam:Ferric_reduct	1053	1202	1.8e-22	PFAM
Pfam:FAD_binding_8	1238	1340	3.1e-20	PFAM
Pfam:NAD_binding_6	1346	1500	1.5e-33	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

99% (88/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes this encoded protein and DUOX1. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation fail to breed and are congenitally hypothyroid (low T4, high TSH), dwarf, and hearing impaired. Anterior pituitaries are dysplastic. Cochlear defects include delayed formation of the inner sulcus and tunnel of Corti and a thickened tectorial membrane. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,286,491		probably null	Het
Adamdec1	A	T	14: 68,568,723	C434*	probably null	Het
Adprhl1	A	G	8: 13,242,391		probably benign	Het
Ago1	T	A	4: 126,463,706	I59F	possibly damaging	Het
Arel1	T	C	12: 84,920,693	T786A	probably damaging	Het
Arhgap26	A	G	18: 39,363,131	K117R	probably benign	Het
Atp6v0b	C	T	4: 117,884,622	G204D	probably damaging	Het
Bace2	T	A	16: 97,436,773		probably null	Het
Camk4	G	A	18: 33,179,625		probably null	Het
Cdh26	C	T	2: 178,481,632	R675C	possibly damaging	Het
Cep152	T	C	2: 125,564,214	E1466G	probably benign	Het
Ces3b	T	C	8: 105,092,635	F441S	probably damaging	Het
Cfap52	T	C	11: 67,926,382	T562A	possibly damaging	Het
Clca3a2	C	A	3: 144,813,898	M238I	possibly damaging	Het
Cntnap5c	A	T	17: 58,102,168	D467V	probably damaging	Het
Col7a1	T	A	9: 108,972,184		probably null	Het
Cstf1	A	G	2: 172,377,710	N247S	possibly damaging	Het
Dffb	G	T	4: 153,974,615	N68K	probably benign	Het
Eftud2	T	A	11: 102,864,725	I228F	probably damaging	Het
Elmo3	T	C	8: 105,309,171	V578A	probably benign	Het
Elp2	A	G	18: 24,631,471	D625G	possibly damaging	Het
Ep300	C	T	15: 81,640,128	P1386S	unknown	Het
Fam120b	A	G	17: 15,417,637	D610G	probably damaging	Het
Fastk	A	T	5: 24,442,178		probably benign	Het
Fbxl6	A	G	15: 76,537,191	S252P	probably damaging	Het
Fbxo43	T	C	15: 36,161,793	K423E	probably damaging	Het
Filip1	T	A	9: 79,819,462	E625V	possibly damaging	Het
Fkbp9	T	A	6: 56,856,378	Y283*	probably null	Het
Gigyf2	T	A	1: 87,379,015	D142E	possibly damaging	Het
Gm10142	T	C	10: 77,716,014		probably null	Het
Golga5	T	C	12: 102,476,188	V262A	probably benign	Het
Hectd4	T	C	5: 121,329,605	V2539A	probably benign	Het
Ica1	G	T	6: 8,653,632	S335*	probably null	Het
Itga1	A	T	13: 115,006,897		probably benign	Het
Itgb1	T	C	8: 128,717,685		probably benign	Het
Itpr1	G	A	6: 108,473,589	V1960I	probably benign	Het
Kcnh4	C	T	11: 100,746,932	G633E	probably benign	Het
Kprp	C	T	3: 92,825,411	V111I	probably benign	Het
Lamc3	T	C	2: 31,940,721	I1490T	probably damaging	Het
Lcp1	A	T	14: 75,227,001	D554V	possibly damaging	Het
Lgi3	A	G	14: 70,534,698	T228A	probably benign	Het
Lipa	A	T	19: 34,501,541	F260I	probably damaging	Het
Lrriq1	C	T	10: 103,215,773	E373K	probably damaging	Het
Map6	G	A	7: 99,336,836	G649D	probably benign	Het
Mccc1	A	G	3: 35,990,047		probably null	Het
Mical3	A	T	6: 120,957,722	S1799T	probably benign	Het
Mmp23	T	A	4: 155,652,132	T151S	probably damaging	Het
Myo1d	T	A	11: 80,674,708	N401I	probably damaging	Het
Myo9b	T	A	8: 71,321,813	S323T	probably damaging	Het
Nbn	G	T	4: 15,979,353	W446L	probably benign	Het
Nedd1	A	T	10: 92,716,265		probably benign	Het
Ngef	C	A	1: 87,487,962		probably benign	Het
Nup153	A	T	13: 46,693,936	N672K	probably benign	Het
Olfr1308	T	C	2: 111,961,016	N19S	probably benign	Het
Olfr149	T	A	9: 39,702,173	I199F	probably damaging	Het
Olfr1509	T	C	14: 52,450,512	V33A	probably benign	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Palm2	T	G	4: 57,710,177	V374G	possibly damaging	Het
Pdlim3	C	A	8: 45,908,460		probably benign	Het
Pmfbp1	G	A	8: 109,541,673	E951K	probably damaging	Het
Pop1	T	A	15: 34,515,891	C548*	probably null	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Ptpdc1	A	T	13: 48,585,980	N658K	probably benign	Het
Ptprk	A	C	10: 28,206,225	E63D	possibly damaging	Het
Rtf1	C	T	2: 119,732,877	R712W	probably damaging	Het
Samd7	A	C	3: 30,751,073	T2P	probably benign	Het
Sft2d1	A	G	17: 8,319,422	T52A	probably benign	Het
Slc25a26	A	G	6: 94,510,833	H91R	probably damaging	Het
Slc5a4a	A	G	10: 76,189,152	E621G	possibly damaging	Het
Slf1	A	T	13: 77,126,632	L28*	probably null	Het
Snapc1	C	T	12: 73,975,032	R81C	probably damaging	Het
Sorcs2	G	A	5: 36,397,553		probably benign	Het
Tacc2	T	C	7: 130,751,825		probably benign	Het
Tas2r140	A	G	6: 133,055,327	V156A	possibly damaging	Het
Terf2ip	C	A	8: 112,018,164	T371K	possibly damaging	Het
Tifa	C	T	3: 127,796,888	L103F	probably damaging	Het
Tmco3	A	G	8: 13,292,037	N104D	probably damaging	Het
Tmem259	T	A	10: 79,978,963	D240V	probably damaging	Het
Trim60	C	T	8: 65,001,048	R183H	probably benign	Het
Trps1	T	C	15: 50,664,743	N725D	probably damaging	Het
Ttn	C	T	2: 76,814,806	V12902M	probably damaging	Het
Ubxn4	G	A	1: 128,262,904	E256K	probably benign	Het
Unc79	A	G	12: 103,112,891	K1772E	probably damaging	Het
Vwde	C	T	6: 13,193,126	V405I	probably benign	Het
Wdr18	T	A	10: 79,966,408	D290E	probably damaging	Het
Wdr92	T	C	11: 17,229,851	L284P	probably damaging	Het
Wwc2	G	A	8: 47,900,721	A126V	probably benign	Het
Zfp882	A	T	8: 71,913,523	I105F	possibly damaging	Het
Zfp942	A	T	17: 21,928,572	C359S	probably benign	Het

Other mutations in Duox2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Duox2	APN	2	122283575	missense	probably benign
IGL00790:Duox2	APN	2	122292300	missense	possibly damaging	0.63
IGL01346:Duox2	APN	2	122287202	splice site	probably benign
IGL01607:Duox2	APN	2	122292319	missense	probably benign	0.00
IGL01798:Duox2	APN	2	122281908	missense	probably damaging	1.00
IGL02000:Duox2	APN	2	122290709	missense	probably benign
IGL02219:Duox2	APN	2	122294664	missense	probably benign	0.01
IGL02227:Duox2	APN	2	122285153	splice site	probably benign
IGL02276:Duox2	APN	2	122294085	missense	probably benign	0.00
IGL02447:Duox2	APN	2	122297468	missense	probably damaging	0.98
IGL02806:Duox2	APN	2	122284666	missense	probably damaging	1.00
IGL03091:Duox2	APN	2	122289474	missense	probably benign	0.03
Bedazzled	UTSW	2	122287121	missense	possibly damaging	0.76
Birthday	UTSW	2	122281871	missense	probably benign
gregorian	UTSW	2	122289345	nonsense	probably null
julian	UTSW	2	122289332	missense	probably benign	0.08
mayan	UTSW	2	122284583	missense	probably benign	0.00
minor	UTSW	2	122281496	missense	probably damaging	1.00
oaf	UTSW	2	122295176	missense	probably damaging	0.98
paltry	UTSW	2	122283060	critical splice donor site	probably null
promethius	UTSW	2	122296381	missense	probably benign
Recruit	UTSW	2	122283897	missense	possibly damaging	0.83
schlemiel	UTSW	2	122289563	missense	probably null	0.89
stumblebum	UTSW	2	122284667	missense	probably damaging	1.00
Two-bit	UTSW	2	122281002	missense	probably benign	0.42
R0049:Duox2	UTSW	2	122296686	missense	possibly damaging	0.48
R0281:Duox2	UTSW	2	122292304	missense	probably benign	0.10
R0378:Duox2	UTSW	2	122284583	missense	probably benign	0.00
R0383:Duox2	UTSW	2	122291810	critical splice donor site	probably null
R0442:Duox2	UTSW	2	122289332	missense	probably benign	0.08
R0524:Duox2	UTSW	2	122281836	missense	possibly damaging	0.80
R0560:Duox2	UTSW	2	122291554	missense	probably benign	0.04
R0562:Duox2	UTSW	2	122289599	missense	probably damaging	1.00
R0645:Duox2	UTSW	2	122292658	missense	probably damaging	1.00
R0704:Duox2	UTSW	2	122284768	missense	probably benign	0.01
R0963:Duox2	UTSW	2	122287172	missense	probably benign	0.03
R1254:Duox2	UTSW	2	122283478	missense	probably damaging	1.00
R1442:Duox2	UTSW	2	122281751	missense	probably benign	0.20
R1473:Duox2	UTSW	2	122287121	missense	possibly damaging	0.76
R1489:Duox2	UTSW	2	122293396	missense	probably benign
R1738:Duox2	UTSW	2	122293414	missense	probably damaging	1.00
R1748:Duox2	UTSW	2	122287051	missense	probably benign	0.00
R1809:Duox2	UTSW	2	122283897	missense	possibly damaging	0.83
R1843:Duox2	UTSW	2	122292258	critical splice donor site	probably null
R1903:Duox2	UTSW	2	122295351	missense	probably damaging	1.00
R1962:Duox2	UTSW	2	122297372	splice site	probably null
R2069:Duox2	UTSW	2	122287108	missense	probably benign	0.01
R2073:Duox2	UTSW	2	122295158	missense	probably damaging	1.00
R2074:Duox2	UTSW	2	122295158	missense	probably damaging	1.00
R2075:Duox2	UTSW	2	122295158	missense	probably damaging	1.00
R2085:Duox2	UTSW	2	122280967	missense	probably damaging	1.00
R3123:Duox2	UTSW	2	122281073	splice site	probably benign
R3907:Duox2	UTSW	2	122283060	critical splice donor site	probably null
R4572:Duox2	UTSW	2	122281726	missense	probably benign	0.00
R4614:Duox2	UTSW	2	122289557	missense	probably damaging	1.00
R4675:Duox2	UTSW	2	122280933	missense	probably damaging	1.00
R4770:Duox2	UTSW	2	122284916	missense	probably benign	0.01
R4817:Duox2	UTSW	2	122296515	missense	probably damaging	0.98
R4931:Duox2	UTSW	2	122296755	missense	probably benign	0.01
R5138:Duox2	UTSW	2	122297531	missense	probably damaging	1.00
R5288:Duox2	UTSW	2	122295136	missense	probably benign
R5344:Duox2	UTSW	2	122281871	missense	probably benign
R5385:Duox2	UTSW	2	122295136	missense	probably benign
R5386:Duox2	UTSW	2	122295136	missense	probably benign
R5493:Duox2	UTSW	2	122281496	missense	probably damaging	1.00
R5632:Duox2	UTSW	2	122281455	missense	probably damaging	1.00
R5742:Duox2	UTSW	2	122284921	missense	probably benign	0.00
R6228:Duox2	UTSW	2	122287193	missense	probably benign	0.38
R6380:Duox2	UTSW	2	122281002	missense	probably benign	0.42
R6398:Duox2	UTSW	2	122296370	missense	probably benign	0.06
R6409:Duox2	UTSW	2	122284667	missense	probably damaging	1.00
R6527:Duox2	UTSW	2	122294614	missense	probably benign	0.29
R6596:Duox2	UTSW	2	122285338	missense	probably benign
R6719:Duox2	UTSW	2	122284386	splice site	probably null
R6981:Duox2	UTSW	2	122291227	missense	possibly damaging	0.95
R7036:Duox2	UTSW	2	122280453	missense	probably damaging	1.00
R7073:Duox2	UTSW	2	122289307	missense	probably damaging	1.00
R7105:Duox2	UTSW	2	122289552	missense	possibly damaging	0.93
R7127:Duox2	UTSW	2	122291949	missense	probably benign	0.02
R7259:Duox2	UTSW	2	122295176	missense	probably damaging	0.98
R7698:Duox2	UTSW	2	122280764	missense	probably damaging	1.00
R7999:Duox2	UTSW	2	122283467	missense	probably benign	0.00
R8103:Duox2	UTSW	2	122287054	missense	probably benign
R8231:Duox2	UTSW	2	122289563	missense	possibly damaging	0.55
R8439:Duox2	UTSW	2	122298155	missense	probably benign
R8712:Duox2	UTSW	2	122289345	nonsense	probably null
R8887:Duox2	UTSW	2	122289563	missense	probably null	0.89
R8909:Duox2	UTSW	2	122296381	missense	probably benign
R9022:Duox2	UTSW	2	122280438	makesense	probably null
R9350:Duox2	UTSW	2	122285248	nonsense	probably null
R9727:Duox2	UTSW	2	122286517	nonsense	probably null
Z1176:Duox2	UTSW	2	122296507	missense	probably damaging	1.00
Z1177:Duox2	UTSW	2	122293452	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCTGGCTCAAGCTATGCAAAGCAG -3'
(R):5'- ACCTAGCAATCAGGCAGGGTAGATG -3'

Sequencing Primer
(F):5'- AAACCAGCATGTAGTGGGGT -3'
(R):5'- AGATATTTGGTCCTTCCTAAGACAGC -3'

Posted On

2013-05-23