Incidental Mutation 'R0244:Bace2'
ID 38016
Institutional Source Beutler Lab
Gene Symbol Bace2
Ensembl Gene ENSMUSG00000040605
Gene Name beta-site APP-cleaving enzyme 2
Synonyms ARP1, 1110059C24Rik, BAE2, ALP56, ASP21, CDA13, CEAP1
MMRRC Submission 038482-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R0244 (G1)
Quality Score 193
Status Validated
Chromosome 16
Chromosomal Location 97157942-97244136 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 97237973 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000047275]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000047275
AA Change: C475S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043918
Gene: ENSMUSG00000040605
AA Change: C475S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Asp 87 427 2.3e-47 PFAM
Pfam:TAXi_C 269 426 4.4e-16 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000231892
Meta Mutation Damage Score 0.5597 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein undergoes proteolytic processing to generate an active endopeptidase enzyme. This transmembrane protease catalyzes the proteolysis of amyloid precursor protein to produce amyloid beta peptide. Mice lacking the encoded product exhibit increased pancreatic beta cell mass and improved glucose tolerance due to increased insulin secretion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired APP processing by neurons and glia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A T 14: 68,806,172 (GRCm39) C434* probably null Het
Adprhl1 A G 8: 13,292,391 (GRCm39) probably benign Het
Ago1 T A 4: 126,357,499 (GRCm39) I59F possibly damaging Het
Arel1 T C 12: 84,967,467 (GRCm39) T786A probably damaging Het
Arhgap26 A G 18: 39,496,184 (GRCm39) K117R probably benign Het
Atp6v0b C T 4: 117,741,819 (GRCm39) G204D probably damaging Het
Bltp2 T A 11: 78,177,317 (GRCm39) probably null Het
Camk4 G A 18: 33,312,678 (GRCm39) probably null Het
Cdh26 C T 2: 178,123,425 (GRCm39) R675C possibly damaging Het
Cep152 T C 2: 125,406,134 (GRCm39) E1466G probably benign Het
Ces3b T C 8: 105,819,267 (GRCm39) F441S probably damaging Het
Cfap52 T C 11: 67,817,208 (GRCm39) T562A possibly damaging Het
Clca3a2 C A 3: 144,519,659 (GRCm39) M238I possibly damaging Het
Cntnap5c A T 17: 58,409,163 (GRCm39) D467V probably damaging Het
Col7a1 T A 9: 108,801,252 (GRCm39) probably null Het
Cstf1 A G 2: 172,219,630 (GRCm39) N247S possibly damaging Het
Dffb G T 4: 154,059,072 (GRCm39) N68K probably benign Het
Dnaaf10 T C 11: 17,179,851 (GRCm39) L284P probably damaging Het
Duox2 C T 2: 122,122,341 (GRCm39) G595S probably benign Het
Eftud2 T A 11: 102,755,551 (GRCm39) I228F probably damaging Het
Elmo3 T C 8: 106,035,803 (GRCm39) V578A probably benign Het
Elp2 A G 18: 24,764,528 (GRCm39) D625G possibly damaging Het
Ep300 C T 15: 81,524,329 (GRCm39) P1386S unknown Het
Fam120b A G 17: 15,637,899 (GRCm39) D610G probably damaging Het
Fastk A T 5: 24,647,176 (GRCm39) probably benign Het
Fbxl6 A G 15: 76,421,391 (GRCm39) S252P probably damaging Het
Fbxo43 T C 15: 36,161,939 (GRCm39) K423E probably damaging Het
Filip1 T A 9: 79,726,744 (GRCm39) E625V possibly damaging Het
Fkbp9 T A 6: 56,833,363 (GRCm39) Y283* probably null Het
Gigyf2 T A 1: 87,306,737 (GRCm39) D142E possibly damaging Het
Gm10142 T C 10: 77,551,848 (GRCm39) probably null Het
Golga5 T C 12: 102,442,447 (GRCm39) V262A probably benign Het
Hectd4 T C 5: 121,467,668 (GRCm39) V2539A probably benign Het
Ica1 G T 6: 8,653,632 (GRCm39) S335* probably null Het
Itga1 A T 13: 115,143,433 (GRCm39) probably benign Het
Itgb1 T C 8: 129,444,166 (GRCm39) probably benign Het
Itpr1 G A 6: 108,450,550 (GRCm39) V1960I probably benign Het
Kcnh4 C T 11: 100,637,758 (GRCm39) G633E probably benign Het
Kprp C T 3: 92,732,718 (GRCm39) V111I probably benign Het
Lamc3 T C 2: 31,830,733 (GRCm39) I1490T probably damaging Het
Lcp1 A T 14: 75,464,441 (GRCm39) D554V possibly damaging Het
Lgi3 A G 14: 70,772,138 (GRCm39) T228A probably benign Het
Lipa A T 19: 34,478,941 (GRCm39) F260I probably damaging Het
Lrriq1 C T 10: 103,051,634 (GRCm39) E373K probably damaging Het
Map6 G A 7: 98,986,043 (GRCm39) G649D probably benign Het
Mccc1 A G 3: 36,044,196 (GRCm39) probably null Het
Mical3 A T 6: 120,934,683 (GRCm39) S1799T probably benign Het
Mmp23 T A 4: 155,736,589 (GRCm39) T151S probably damaging Het
Myo1d T A 11: 80,565,534 (GRCm39) N401I probably damaging Het
Myo9b T A 8: 71,774,457 (GRCm39) S323T probably damaging Het
Nbn G T 4: 15,979,353 (GRCm39) W446L probably benign Het
Nedd1 A T 10: 92,552,127 (GRCm39) probably benign Het
Ngef C A 1: 87,415,684 (GRCm39) probably benign Het
Nup153 A T 13: 46,847,412 (GRCm39) N672K probably benign Het
Or10d1b T A 9: 39,613,469 (GRCm39) I199F probably damaging Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or4e2 T C 14: 52,687,969 (GRCm39) V33A probably benign Het
Or4f57 T C 2: 111,791,361 (GRCm39) N19S probably benign Het
Pakap T G 4: 57,710,177 (GRCm39) V374G possibly damaging Het
Pdlim3 C A 8: 46,361,497 (GRCm39) probably benign Het
Pmfbp1 G A 8: 110,268,305 (GRCm39) E951K probably damaging Het
Pop1 T A 15: 34,516,037 (GRCm39) C548* probably null Het
Ppp1r16a C T 15: 76,574,999 (GRCm39) probably benign Het
Ptpdc1 A T 13: 48,739,456 (GRCm39) N658K probably benign Het
Ptprk A C 10: 28,082,221 (GRCm39) E63D possibly damaging Het
Rtf1 C T 2: 119,563,358 (GRCm39) R712W probably damaging Het
Samd7 A C 3: 30,805,222 (GRCm39) T2P probably benign Het
Sft2d1 A G 17: 8,538,254 (GRCm39) T52A probably benign Het
Slc25a26 A G 6: 94,487,814 (GRCm39) H91R probably damaging Het
Slc5a4a A G 10: 76,024,986 (GRCm39) E621G possibly damaging Het
Slf1 A T 13: 77,274,751 (GRCm39) L28* probably null Het
Snapc1 C T 12: 74,021,806 (GRCm39) R81C probably damaging Het
Sorcs2 G A 5: 36,554,897 (GRCm39) probably benign Het
Tacc2 T C 7: 130,353,555 (GRCm39) probably benign Het
Tas2r140 A G 6: 133,032,290 (GRCm39) V156A possibly damaging Het
Terf2ip C A 8: 112,744,796 (GRCm39) T371K possibly damaging Het
Tifa C T 3: 127,590,537 (GRCm39) L103F probably damaging Het
Tmco3 A G 8: 13,342,037 (GRCm39) N104D probably damaging Het
Tmem259 T A 10: 79,814,797 (GRCm39) D240V probably damaging Het
Trim60 C T 8: 65,453,700 (GRCm39) R183H probably benign Het
Trps1 T C 15: 50,528,139 (GRCm39) N725D probably damaging Het
Ttn C T 2: 76,645,150 (GRCm39) V12902M probably damaging Het
Ubxn4 G A 1: 128,190,641 (GRCm39) E256K probably benign Het
Unc79 A G 12: 103,079,150 (GRCm39) K1772E probably damaging Het
Vwde C T 6: 13,193,125 (GRCm39) V405I probably benign Het
Wdr18 T A 10: 79,802,242 (GRCm39) D290E probably damaging Het
Wwc2 G A 8: 48,353,756 (GRCm39) A126V probably benign Het
Zfp882 A T 8: 72,667,367 (GRCm39) I105F possibly damaging Het
Zfp942 A T 17: 22,147,553 (GRCm39) C359S probably benign Het
Other mutations in Bace2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Bace2 APN 16 97,209,630 (GRCm39) missense probably damaging 0.97
IGL02660:Bace2 APN 16 97,216,340 (GRCm39) missense probably damaging 1.00
IGL02669:Bace2 APN 16 97,238,093 (GRCm39) makesense probably null
R0674:Bace2 UTSW 16 97,237,949 (GRCm39) missense possibly damaging 0.93
R0906:Bace2 UTSW 16 97,158,141 (GRCm39) missense possibly damaging 0.67
R1078:Bace2 UTSW 16 97,158,060 (GRCm39) missense unknown
R1670:Bace2 UTSW 16 97,213,335 (GRCm39) missense probably damaging 0.96
R1997:Bace2 UTSW 16 97,216,289 (GRCm39) missense possibly damaging 0.93
R2050:Bace2 UTSW 16 97,213,336 (GRCm39) missense probably damaging 1.00
R2937:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R2938:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R3103:Bace2 UTSW 16 97,223,201 (GRCm39) critical splice donor site probably null
R3755:Bace2 UTSW 16 97,237,857 (GRCm39) missense probably benign 0.34
R4110:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4112:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4113:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4560:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4562:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4563:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4717:Bace2 UTSW 16 97,238,073 (GRCm39) missense probably damaging 1.00
R5535:Bace2 UTSW 16 97,214,625 (GRCm39) missense probably damaging 1.00
R6282:Bace2 UTSW 16 97,216,297 (GRCm39) missense probably damaging 1.00
R6364:Bace2 UTSW 16 97,214,633 (GRCm39) missense probably benign 0.05
R7045:Bace2 UTSW 16 97,200,865 (GRCm39) missense probably damaging 1.00
R7241:Bace2 UTSW 16 97,237,998 (GRCm39) missense possibly damaging 0.92
R7546:Bace2 UTSW 16 97,200,882 (GRCm39) missense probably benign 0.01
R7653:Bace2 UTSW 16 97,237,852 (GRCm39) missense
R8026:Bace2 UTSW 16 97,238,052 (GRCm39) missense probably benign 0.26
R8171:Bace2 UTSW 16 97,225,786 (GRCm39) missense possibly damaging 0.86
R8324:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8341:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8480:Bace2 UTSW 16 97,214,670 (GRCm39) missense probably damaging 1.00
R9205:Bace2 UTSW 16 97,158,059 (GRCm39) missense unknown
R9221:Bace2 UTSW 16 97,209,692 (GRCm39) missense probably benign 0.01
X0024:Bace2 UTSW 16 97,214,598 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGTAAGGGCTTCTTGACTCAC -3'
(R):5'- AGTCTGGAAGGCATTCAGTTGCAC -3'

Sequencing Primer
(F):5'- TGTCTGAAATTTCTGGGCCC -3'
(R):5'- CAGTTGAGGTTCCCGACTAATAG -3'
Posted On 2013-05-23