Incidental Mutation 'R4949:Tmbim1'
ID383646
Institutional Source Beutler Lab
Gene Symbol Tmbim1
Ensembl Gene ENSMUSG00000006301
Gene Nametransmembrane BAX inhibitor motif containing 1
Synonyms
MMRRC Submission 042546-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R4949 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location74288247-74305622 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 74295365 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 12 (D12A)
Ref Sequence ENSEMBL: ENSMUSP00000115444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016309] [ENSMUST00000027370] [ENSMUST00000087226] [ENSMUST00000113796] [ENSMUST00000130763] [ENSMUST00000141560]
Predicted Effect probably damaging
Transcript: ENSMUST00000016309
AA Change: D12A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000016309
Gene: ENSMUSG00000006301
AA Change: D12A

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 33 65 N/A INTRINSIC
Pfam:Bax1-I 94 305 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000027370
SMART Domains Protein: ENSMUSP00000027370
Gene: ENSMUSG00000026179

DomainStartEndE-ValueType
Blast:Lactamase_B 4 79 1e-24 BLAST
Lactamase_B 129 291 1.05e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087226
SMART Domains Protein: ENSMUSP00000084478
Gene: ENSMUSG00000026179

DomainStartEndE-ValueType
low complexity region 43 61 N/A INTRINSIC
Pfam:DUF4748 71 121 2.9e-23 PFAM
Lactamase_B 168 330 1.05e-31 SMART
Pfam:HAGH_C 331 421 6.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113796
AA Change: D12A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109427
Gene: ENSMUSG00000006301
AA Change: D12A

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 33 65 N/A INTRINSIC
Pfam:Bax1-I 94 305 4.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128505
SMART Domains Protein: ENSMUSP00000122874
Gene: ENSMUSG00000006301

DomainStartEndE-ValueType
Pfam:Bax1-I 1 152 3.3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130763
AA Change: D12A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121814
Gene: ENSMUSG00000006301
AA Change: D12A

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 33 65 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138620
Predicted Effect probably damaging
Transcript: ENSMUST00000141560
AA Change: D12A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115444
Gene: ENSMUSG00000006301
AA Change: D12A

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 33 65 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187941
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit susceptibility to cystic medial degeneration without inflammation or change in blood pressure and are prone to aortic dilation with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,109,706 S258R probably damaging Het
Acox3 T C 5: 35,612,106 V692A probably benign Het
Bcl2l13 G T 6: 120,887,230 G382W probably damaging Het
Cdhr5 T A 7: 141,272,644 N353I probably damaging Het
Chil4 A G 3: 106,206,092 S170P possibly damaging Het
Clp1 A C 2: 84,723,742 M361R possibly damaging Het
Cylc2 A G 4: 51,229,804 K382R unknown Het
Dsg2 T A 18: 20,590,184 D422E probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Gm14295 A C 2: 176,809,676 T320P probably damaging Het
Ido2 T G 8: 24,533,954 probably null Het
Ift140 T A 17: 25,094,665 S1357T probably benign Het
Insr T G 8: 3,185,059 E145A probably benign Het
Itpripl1 A G 2: 127,141,407 M265T probably benign Het
Kcnb1 G T 2: 167,105,601 N442K probably damaging Het
Kifc5b C A 17: 26,925,514 R536S probably damaging Het
Klf6 A T 13: 5,864,948 S129C probably benign Het
Lpin2 C G 17: 71,231,339 P327A probably damaging Het
Lsm1 T C 8: 25,802,037 V114A probably benign Het
Map7d1 C T 4: 126,235,053 W218* probably null Het
N4bp2 T A 5: 65,821,799 probably null Het
Rheb A T 5: 24,803,731 I163K possibly damaging Het
Rph3a T C 5: 120,963,834 D113G probably damaging Het
Scn8a A G 15: 101,029,782 N1381D probably damaging Het
Sdsl T A 5: 120,459,805 N208Y possibly damaging Het
Serpinb9e A G 13: 33,251,608 N8S possibly damaging Het
Sox18 G A 2: 181,671,224 Q100* probably null Het
Taar8b C T 10: 24,091,927 C123Y probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tes C A 6: 17,100,360 H331N probably benign Het
Tmprss4 T C 9: 45,175,543 I307V possibly damaging Het
Ttll1 A T 15: 83,502,173 M77K probably null Het
Ttpal G A 2: 163,613,751 R220Q probably damaging Het
Vmn1r230 T A 17: 20,847,363 H271Q probably benign Het
Vmn2r32 A G 7: 7,464,084 I815T probably benign Het
Other mutations in Tmbim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Tmbim1 APN 1 74295263 missense probably damaging 1.00
IGL03062:Tmbim1 APN 1 74291699 missense possibly damaging 0.63
IGL03306:Tmbim1 APN 1 74293066 missense probably damaging 1.00
R0987:Tmbim1 UTSW 1 74293924 unclassified probably null
R1067:Tmbim1 UTSW 1 74290746 unclassified probably benign
R3821:Tmbim1 UTSW 1 74293930 missense probably damaging 1.00
R3881:Tmbim1 UTSW 1 74289998 unclassified probably benign
R4254:Tmbim1 UTSW 1 74293931 missense probably damaging 1.00
R4787:Tmbim1 UTSW 1 74295360 missense possibly damaging 0.74
R4906:Tmbim1 UTSW 1 74289409 missense probably damaging 1.00
R5487:Tmbim1 UTSW 1 74293005 missense probably benign 0.02
R6257:Tmbim1 UTSW 1 74293066 missense probably damaging 1.00
R7347:Tmbim1 UTSW 1 74291279 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGGTTCCTCAGTGCCAAG -3'
(R):5'- AATGGCATGTGTAAGCTACAGAC -3'

Sequencing Primer
(F):5'- AGTGCCAAGCTCTACCTTG -3'
(R):5'- CATGTGTAAGCTACAGACATAGC -3'
Posted On2016-04-27