Incidental Mutation 'R4949:Kifc5b'
ID383685
Institutional Source Beutler Lab
Gene Symbol Kifc5b
Ensembl Gene ENSMUSG00000024301
Gene Namekinesin family member C5B
Synonymskinesin family c-terminal 5B
MMRRC Submission 042546-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.507) question?
Stock #R4949 (G1)
Quality Score219
Status Not validated
Chromosome17
Chromosomal Location26917091-26932579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 26925514 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 536 (R536S)
Ref Sequence ENSEMBL: ENSMUSP00000077984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078961]
Predicted Effect probably damaging
Transcript: ENSMUST00000078961
AA Change: R536S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077984
Gene: ENSMUSG00000024301
AA Change: R536S

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 222 240 N/A INTRINSIC
KISc 307 670 1.34e-143 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184919
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,109,706 S258R probably damaging Het
Acox3 T C 5: 35,612,106 V692A probably benign Het
Bcl2l13 G T 6: 120,887,230 G382W probably damaging Het
Cdhr5 T A 7: 141,272,644 N353I probably damaging Het
Chil4 A G 3: 106,206,092 S170P possibly damaging Het
Clp1 A C 2: 84,723,742 M361R possibly damaging Het
Cylc2 A G 4: 51,229,804 K382R unknown Het
Dsg2 T A 18: 20,590,184 D422E probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Gm14295 A C 2: 176,809,676 T320P probably damaging Het
Ido2 T G 8: 24,533,954 probably null Het
Ift140 T A 17: 25,094,665 S1357T probably benign Het
Insr T G 8: 3,185,059 E145A probably benign Het
Itpripl1 A G 2: 127,141,407 M265T probably benign Het
Kcnb1 G T 2: 167,105,601 N442K probably damaging Het
Klf6 A T 13: 5,864,948 S129C probably benign Het
Lpin2 C G 17: 71,231,339 P327A probably damaging Het
Lsm1 T C 8: 25,802,037 V114A probably benign Het
Map7d1 C T 4: 126,235,053 W218* probably null Het
N4bp2 T A 5: 65,821,799 probably null Het
Rheb A T 5: 24,803,731 I163K possibly damaging Het
Rph3a T C 5: 120,963,834 D113G probably damaging Het
Scn8a A G 15: 101,029,782 N1381D probably damaging Het
Sdsl T A 5: 120,459,805 N208Y possibly damaging Het
Serpinb9e A G 13: 33,251,608 N8S possibly damaging Het
Sox18 G A 2: 181,671,224 Q100* probably null Het
Taar8b C T 10: 24,091,927 C123Y probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tes C A 6: 17,100,360 H331N probably benign Het
Tmbim1 T G 1: 74,295,365 D12A probably damaging Het
Tmprss4 T C 9: 45,175,543 I307V possibly damaging Het
Ttll1 A T 15: 83,502,173 M77K probably null Het
Ttpal G A 2: 163,613,751 R220Q probably damaging Het
Vmn1r230 T A 17: 20,847,363 H271Q probably benign Het
Vmn2r32 A G 7: 7,464,084 I815T probably benign Het
Other mutations in Kifc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Kifc5b APN 17 26924744 missense possibly damaging 0.82
IGL01886:Kifc5b APN 17 26932117 missense probably damaging 0.99
FR4449:Kifc5b UTSW 17 26924217 missense probably benign
R0394:Kifc5b UTSW 17 26923082 missense probably benign 0.37
R0800:Kifc5b UTSW 17 26923184 missense probably benign 0.01
R0890:Kifc5b UTSW 17 26923022 missense possibly damaging 0.67
R1122:Kifc5b UTSW 17 26924061 missense probably benign 0.01
R1651:Kifc5b UTSW 17 26925530 missense probably damaging 1.00
R1875:Kifc5b UTSW 17 26917290 splice site probably null
R1955:Kifc5b UTSW 17 26926297 critical splice donor site probably null
R2279:Kifc5b UTSW 17 26925541 missense probably damaging 0.99
R4921:Kifc5b UTSW 17 26921023 missense probably damaging 1.00
R5044:Kifc5b UTSW 17 26924787 missense probably damaging 1.00
R6144:Kifc5b UTSW 17 26921852 missense probably benign 0.01
R6393:Kifc5b UTSW 17 26921842 missense probably benign 0.08
R6484:Kifc5b UTSW 17 26924772 missense probably damaging 1.00
R7075:Kifc5b UTSW 17 26925898 missense probably benign 0.30
R7385:Kifc5b UTSW 17 26925623 missense probably damaging 1.00
R7743:Kifc5b UTSW 17 26924202 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACACACTCACTCTGTTGC -3'
(R):5'- CCTACCTTATTGCTCAGGGC -3'

Sequencing Primer
(F):5'- ACTCTGTTGCTCTGCGGC -3'
(R):5'- TATTGCTCAGGGCCATTATGACCAG -3'
Posted On2016-04-27