Incidental Mutation 'R5017:Phldb3'
ID385612
Institutional Source Beutler Lab
Gene Symbol Phldb3
Ensembl Gene ENSMUSG00000074277
Gene Namepleckstrin homology like domain, family B, member 3
SynonymsEG232970, Gm10102
MMRRC Submission 042608-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R5017 (G1)
Quality Score203
Status Validated
Chromosome7
Chromosomal Location24610763-24629297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24620096 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 353 (T353M)
Ref Sequence ENSEMBL: ENSMUSP00000146187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073325] [ENSMUST00000206422]
Predicted Effect probably damaging
Transcript: ENSMUST00000073325
AA Change: T353M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073047
Gene: ENSMUSG00000074277
AA Change: T353M

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
low complexity region 61 74 N/A INTRINSIC
coiled coil region 111 302 N/A INTRINSIC
low complexity region 364 374 N/A INTRINSIC
Blast:PH 389 447 2e-29 BLAST
Blast:PH 457 488 4e-6 BLAST
low complexity region 490 514 N/A INTRINSIC
PH 541 645 1.54e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205857
Predicted Effect probably damaging
Transcript: ENSMUST00000206422
AA Change: T353M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 87.9%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,676 F167I unknown Het
Adamdec1 T C 14: 68,573,245 D154G probably benign Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arhgef3 G T 14: 27,265,530 R20L possibly damaging Het
Birc2 A T 9: 7,818,885 C568* probably null Het
Cep44 A G 8: 56,544,207 S99P possibly damaging Het
Clstn2 A G 9: 97,483,086 W456R probably damaging Het
Cog5 T A 12: 31,920,605 S783T probably benign Het
Endod1 G A 9: 14,356,891 R433* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gdpd4 C A 7: 98,004,275 Y498* probably null Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Ifit3 A C 19: 34,587,192 N46T possibly damaging Het
Kcnh8 T C 17: 52,893,930 L464S probably damaging Het
Lrrc9 C A 12: 72,506,325 R1334S possibly damaging Het
Macf1 A G 4: 123,452,113 F2631L probably damaging Het
Mafa T C 15: 75,747,489 H145R probably benign Het
Muc6 T C 7: 141,640,528 T1411A probably benign Het
Nos3 A G 5: 24,366,719 probably benign Het
Nwd2 T A 5: 63,650,141 probably benign Het
Olfr160 A T 9: 37,711,525 Y251* probably null Het
Olfr44 A T 9: 39,484,755 M166K possibly damaging Het
Olfr981 A T 9: 40,022,376 probably benign Het
Pde11a A T 2: 76,136,367 D579E probably benign Het
Phkb A T 8: 86,049,809 H954L probably benign Het
Pigu A T 2: 155,299,208 probably null Het
Pla2r1 A G 2: 60,522,760 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Setbp1 C A 18: 78,856,594 G1286V possibly damaging Het
Siglecg T A 7: 43,411,386 probably benign Het
Slc25a46 A T 18: 31,605,783 H118Q probably damaging Het
Sycp1 A T 3: 102,895,987 probably null Het
Tmem132c A G 5: 127,563,350 T862A probably benign Het
Tmem256 T C 11: 69,838,992 probably benign Het
Tpr A T 1: 150,398,637 E98D probably benign Het
Trdn A G 10: 33,468,159 D623G probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trpm1 T C 7: 64,244,832 probably benign Het
Uhrf1bp1 T A 17: 27,894,739 L1295* probably null Het
Vmn1r227 T C 17: 20,736,078 noncoding transcript Het
Xpo6 G A 7: 126,104,747 A21V probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Phldb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Phldb3 APN 7 24628870 missense probably damaging 1.00
IGL01683:Phldb3 APN 7 24619437 missense possibly damaging 0.71
IGL01732:Phldb3 APN 7 24627326 missense probably damaging 1.00
IGL01765:Phldb3 APN 7 24617375 missense possibly damaging 0.55
IGL03103:Phldb3 APN 7 24624176 missense possibly damaging 0.71
FR4548:Phldb3 UTSW 7 24628978 makesense probably null
R0052:Phldb3 UTSW 7 24612579 missense probably benign 0.01
R0230:Phldb3 UTSW 7 24612579 missense probably benign 0.01
R0234:Phldb3 UTSW 7 24612579 missense probably benign 0.01
R0655:Phldb3 UTSW 7 24624372 missense probably benign 0.07
R1731:Phldb3 UTSW 7 24619235 missense probably benign 0.10
R1935:Phldb3 UTSW 7 24617407 missense probably benign 0.01
R1936:Phldb3 UTSW 7 24617407 missense probably benign 0.01
R2155:Phldb3 UTSW 7 24612645 missense probably damaging 1.00
R2410:Phldb3 UTSW 7 24624294 missense probably benign 0.01
R4249:Phldb3 UTSW 7 24627320 missense probably damaging 1.00
R4501:Phldb3 UTSW 7 24612561 missense probably benign
R4665:Phldb3 UTSW 7 24611427 missense probably benign 0.00
R4916:Phldb3 UTSW 7 24624291 missense probably benign
R4970:Phldb3 UTSW 7 24624685 missense possibly damaging 0.73
R5112:Phldb3 UTSW 7 24624685 missense possibly damaging 0.73
R5864:Phldb3 UTSW 7 24624146 missense possibly damaging 0.55
R5881:Phldb3 UTSW 7 24626722 critical splice donor site probably null
R6176:Phldb3 UTSW 7 24626702 missense probably damaging 1.00
R6756:Phldb3 UTSW 7 24627331 missense probably damaging 1.00
R6800:Phldb3 UTSW 7 24624152 missense possibly damaging 0.93
R7223:Phldb3 UTSW 7 24624653 missense probably benign
R7485:Phldb3 UTSW 7 24611264 start gained probably benign
R7707:Phldb3 UTSW 7 24626597 missense possibly damaging 0.80
RF010:Phldb3 UTSW 7 24626495 frame shift probably null
RF031:Phldb3 UTSW 7 24626493 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTGTCCTGAAACCAAGCCC -3'
(R):5'- AGCAGTGAAGGCTCCTGATG -3'

Sequencing Primer
(F):5'- CCTAATGTACGCACATGTGTG -3'
(R):5'- TGAAGGCTCCTGATGGACCG -3'
Posted On2016-05-10