Mutagenetix > Incidental Mutations

Incidental Mutation 'R5017:Siglecg'

385613

Institutional Source

Beutler Lab

Gene Symbol

Siglecg

Ensembl Gene

ENSMUSG00000030468

Gene Name

sialic acid binding Ig-like lectin G

Synonyms

mSiglec-G, A630096C01Rik

MMRRC Submission

042608-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.074) question?

Stock #

R5017 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43408204-43418358 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to A at 43411386 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000005592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005592]

Predicted Effect

probably benign
Transcript: ENSMUST00000005592

SMART Domains

Protein: ENSMUSP00000005592
Gene: ENSMUSG00000030468

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	27	139	5.21e-2	SMART
IG_like	148	232	8.97e0	SMART
IGc2	262	325	3.38e-10	SMART
IGc2	366	427	8.26e-5	SMART
low complexity region	473	480	N/A	INTRINSIC
transmembrane domain	545	564	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123042

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124502

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124885

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131744

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154322

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.1%
3x: 97.0%
10x: 94.3%
20x: 87.9%

Validation Efficiency

96% (46/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	A	T	10: 82,296,676	F167I	unknown	Het
Adamdec1	T	C	14: 68,573,245	D154G	probably benign	Het
Agbl5	G	A	5: 30,903,059	R141Q	probably damaging	Het
Arhgef3	G	T	14: 27,265,530	R20L	possibly damaging	Het
Birc2	A	T	9: 7,818,885	C568*	probably null	Het
Cep44	A	G	8: 56,544,207	S99P	possibly damaging	Het
Clstn2	A	G	9: 97,483,086	W456R	probably damaging	Het
Cog5	T	A	12: 31,920,605	S783T	probably benign	Het
Endod1	G	A	9: 14,356,891	R433*	probably null	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Gdpd4	C	A	7: 98,004,275	Y498*	probably null	Het
Gm10722	T	C	9: 3,000,937	C6R	probably benign	Het
Hapln2	A	G	3: 88,024,001	V69A	probably damaging	Het
Ifit3	A	C	19: 34,587,192	N46T	possibly damaging	Het
Kcnh8	T	C	17: 52,893,930	L464S	probably damaging	Het
Lrrc9	C	A	12: 72,506,325	R1334S	possibly damaging	Het
Macf1	A	G	4: 123,452,113	F2631L	probably damaging	Het
Mafa	T	C	15: 75,747,489	H145R	probably benign	Het
Muc6	T	C	7: 141,640,528	T1411A	probably benign	Het
Nos3	A	G	5: 24,366,719		probably benign	Het
Nwd2	T	A	5: 63,650,141		probably benign	Het
Olfr160	A	T	9: 37,711,525	Y251*	probably null	Het
Olfr44	A	T	9: 39,484,755	M166K	possibly damaging	Het
Olfr981	A	T	9: 40,022,376		probably benign	Het
Pde11a	A	T	2: 76,136,367	D579E	probably benign	Het
Phkb	A	T	8: 86,049,809	H954L	probably benign	Het
Phldb3	C	T	7: 24,620,096	T353M	probably damaging	Het
Pigu	A	T	2: 155,299,208		probably null	Het
Pla2r1	A	G	2: 60,522,760		probably null	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Setbp1	C	A	18: 78,856,594	G1286V	possibly damaging	Het
Slc25a46	A	T	18: 31,605,783	H118Q	probably damaging	Het
Sycp1	A	T	3: 102,895,987		probably null	Het
Tmem132c	A	G	5: 127,563,350	T862A	probably benign	Het
Tmem256	T	C	11: 69,838,992		probably benign	Het
Tpr	A	T	1: 150,398,637	E98D	probably benign	Het
Trdn	A	G	10: 33,468,159	D623G	probably benign	Het
Trip11	T	C	12: 101,846,620	N1485S	probably benign	Het
Trpm1	T	C	7: 64,244,832		probably benign	Het
Uhrf1bp1	T	A	17: 27,894,739	L1295*	probably null	Het
Vmn1r227	T	C	17: 20,736,078		noncoding transcript	Het
Xpo6	G	A	7: 126,104,747	A21V	probably benign	Het
Zfp276	A	G	8: 123,264,977		probably benign	Het

Other mutations in Siglecg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00528:Siglecg	APN	7	43409057	missense	possibly damaging	0.64
IGL00556:Siglecg	APN	7	43411795	missense	probably benign	0.02
IGL01806:Siglecg	APN	7	43411464	splice site	probably null
IGL01947:Siglecg	APN	7	43408763	missense	probably benign	0.43
IGL02257:Siglecg	APN	7	43411904	missense	probably benign	0.00
IGL02410:Siglecg	APN	7	43408829	missense	probably damaging	0.99
IGL02454:Siglecg	APN	7	43408895	missense	probably benign	0.00
Chamonix	UTSW	7	43409422	missense	possibly damaging	0.91
Montblanc	UTSW	7	43411386	intron	probably benign
Shenandoah	UTSW	7	43408802	missense	probably damaging	0.99
shenandoah2	UTSW	7	43412017	missense	possibly damaging	0.82
Sherando	UTSW	7	43409057	missense	possibly damaging	0.64
Smokies	UTSW	7	43409279	missense	probably benign	0.02
IGL02988:Siglecg	UTSW	7	43418052	missense	probably damaging	1.00
R0134:Siglecg	UTSW	7	43411171	missense	probably damaging	1.00
R0225:Siglecg	UTSW	7	43411171	missense	probably damaging	1.00
R0480:Siglecg	UTSW	7	43411126	missense	probably benign	0.42
R1538:Siglecg	UTSW	7	43417889	missense	possibly damaging	0.53
R1681:Siglecg	UTSW	7	43408941	missense	probably benign	0.17
R2358:Siglecg	UTSW	7	43409422	missense	possibly damaging	0.91
R4428:Siglecg	UTSW	7	43417926	missense	possibly damaging	0.84
R4429:Siglecg	UTSW	7	43417926	missense	possibly damaging	0.84
R4736:Siglecg	UTSW	7	43417908	missense	probably benign	0.03
R4754:Siglecg	UTSW	7	43411871	intron	probably benign
R5713:Siglecg	UTSW	7	43408802	missense	probably damaging	0.99
R5777:Siglecg	UTSW	7	43409413	missense	possibly damaging	0.80
R5892:Siglecg	UTSW	7	43412204	intron	probably benign
R6153:Siglecg	UTSW	7	43412017	missense	possibly damaging	0.82
R6154:Siglecg	UTSW	7	43412017	missense	possibly damaging	0.82
R6331:Siglecg	UTSW	7	43408754	missense	possibly damaging	0.83
R6562:Siglecg	UTSW	7	43409057	missense	possibly damaging	0.64
R6749:Siglecg	UTSW	7	43408979	missense	probably benign	0.00
R7066:Siglecg	UTSW	7	43411742	missense	probably benign	0.40
R7884:Siglecg	UTSW	7	43409279	missense	probably benign	0.02
R8275:Siglecg	UTSW	7	43412468	missense	probably benign
R8554:Siglecg	UTSW	7	43408896	missense	probably benign	0.01
RF006:Siglecg	UTSW	7	43408864	nonsense	probably null
Z1177:Siglecg	UTSW	7	43412022	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATACCCTGGACCTCTCTGTG -3'
(R):5'- GCATTCCTGAGGATTTCCAACAC -3'

Sequencing Primer
(F):5'- GCTGTGTGAGTATGATCTACCAAAG -3'
(R):5'- CTGAGGATTTCCAACACTGGGG -3'

Posted On

2016-05-10