Incidental Mutation 'R5017:Endod1'
ID385622
Institutional Source Beutler Lab
Gene Symbol Endod1
Ensembl Gene ENSMUSG00000037419
Gene Nameendonuclease domain containing 1
Synonyms2210414F18Rik, 2310067E08Rik
MMRRC Submission 042608-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5017 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location14353990-14381507 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 14356891 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 433 (R433*)
Ref Sequence ENSEMBL: ENSMUSP00000127751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167549]
Predicted Effect probably null
Transcript: ENSMUST00000167549
AA Change: R433*
SMART Domains Protein: ENSMUSP00000127751
Gene: ENSMUSG00000037419
AA Change: R433*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Endonuclease_NS 61 261 9.04e-1 SMART
NUC 62 264 1.64e-3 SMART
coiled coil region 271 299 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 467 486 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213403
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 87.9%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,676 F167I unknown Het
Adamdec1 T C 14: 68,573,245 D154G probably benign Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arhgef3 G T 14: 27,265,530 R20L possibly damaging Het
Birc2 A T 9: 7,818,885 C568* probably null Het
Cep44 A G 8: 56,544,207 S99P possibly damaging Het
Clstn2 A G 9: 97,483,086 W456R probably damaging Het
Cog5 T A 12: 31,920,605 S783T probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gdpd4 C A 7: 98,004,275 Y498* probably null Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Ifit3 A C 19: 34,587,192 N46T possibly damaging Het
Kcnh8 T C 17: 52,893,930 L464S probably damaging Het
Lrrc9 C A 12: 72,506,325 R1334S possibly damaging Het
Macf1 A G 4: 123,452,113 F2631L probably damaging Het
Mafa T C 15: 75,747,489 H145R probably benign Het
Muc6 T C 7: 141,640,528 T1411A probably benign Het
Nos3 A G 5: 24,366,719 probably benign Het
Nwd2 T A 5: 63,650,141 probably benign Het
Olfr160 A T 9: 37,711,525 Y251* probably null Het
Olfr44 A T 9: 39,484,755 M166K possibly damaging Het
Olfr981 A T 9: 40,022,376 probably benign Het
Pde11a A T 2: 76,136,367 D579E probably benign Het
Phkb A T 8: 86,049,809 H954L probably benign Het
Phldb3 C T 7: 24,620,096 T353M probably damaging Het
Pigu A T 2: 155,299,208 probably null Het
Pla2r1 A G 2: 60,522,760 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Setbp1 C A 18: 78,856,594 G1286V possibly damaging Het
Siglecg T A 7: 43,411,386 probably benign Het
Slc25a46 A T 18: 31,605,783 H118Q probably damaging Het
Sycp1 A T 3: 102,895,987 probably null Het
Tmem132c A G 5: 127,563,350 T862A probably benign Het
Tmem256 T C 11: 69,838,992 probably benign Het
Tpr A T 1: 150,398,637 E98D probably benign Het
Trdn A G 10: 33,468,159 D623G probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trpm1 T C 7: 64,244,832 probably benign Het
Uhrf1bp1 T A 17: 27,894,739 L1295* probably null Het
Vmn1r227 T C 17: 20,736,078 noncoding transcript Het
Xpo6 G A 7: 126,104,747 A21V probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Endod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Endod1 APN 9 14356753 missense possibly damaging 0.93
IGL01302:Endod1 APN 9 14357239 missense possibly damaging 0.50
IGL02895:Endod1 APN 9 14356870 missense probably benign 0.06
IGL02994:Endod1 APN 9 14356887 missense possibly damaging 0.93
IGL03120:Endod1 APN 9 14357035 missense probably damaging 0.98
royal_gorge UTSW 9 14356870 missense probably benign 0.06
R0745:Endod1 UTSW 9 14357117 missense possibly damaging 0.92
R1087:Endod1 UTSW 9 14357193 missense possibly damaging 0.69
R1829:Endod1 UTSW 9 14356926 missense probably damaging 1.00
R1857:Endod1 UTSW 9 14357109 missense probably benign 0.05
R2120:Endod1 UTSW 9 14357653 missense probably benign 0.07
R3906:Endod1 UTSW 9 14380855 missense probably benign 0.12
R4801:Endod1 UTSW 9 14357023 missense probably benign 0.05
R4802:Endod1 UTSW 9 14357023 missense probably benign 0.05
R6027:Endod1 UTSW 9 14357597 nonsense probably null
R6179:Endod1 UTSW 9 14357461 missense probably benign 0.00
R6279:Endod1 UTSW 9 14356870 missense probably benign 0.06
R6300:Endod1 UTSW 9 14356870 missense probably benign 0.06
R6986:Endod1 UTSW 9 14357310 missense probably damaging 1.00
R7314:Endod1 UTSW 9 14356999 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGTAGCCAATCCGCTTGAAG -3'
(R):5'- ATAGTCCATCTCCTTTGGTTGG -3'

Sequencing Primer
(F):5'- GCTTGAAGACACTAAAAACAATCTG -3'
(R):5'- ACACTGTTGAGAGTTGCCTATACC -3'
Posted On2016-05-10