Incidental Mutation 'R3906:Endod1'
ID309189
Institutional Source Beutler Lab
Gene Symbol Endod1
Ensembl Gene ENSMUSG00000037419
Gene Nameendonuclease domain containing 1
Synonyms2210414F18Rik, 2310067E08Rik
MMRRC Submission 040813-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R3906 (G1)
Quality Score175
Status Validated
Chromosome9
Chromosomal Location14353990-14381507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14380855 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 39 (Y39F)
Ref Sequence ENSEMBL: ENSMUSP00000149823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167549] [ENSMUST00000214236]
Predicted Effect probably benign
Transcript: ENSMUST00000167549
AA Change: Y39F

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127751
Gene: ENSMUSG00000037419
AA Change: Y39F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Endonuclease_NS 61 261 9.04e-1 SMART
NUC 62 264 1.64e-3 SMART
coiled coil region 271 299 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 467 486 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213403
Predicted Effect probably benign
Transcript: ENSMUST00000214236
AA Change: Y39F

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215810
Meta Mutation Damage Score 0.0807 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Cd1d1 A G 3: 86,998,756 W71R probably damaging Het
Cdhr3 A G 12: 33,053,428 F397L probably damaging Het
Ces2a A G 8: 104,739,308 I325V probably benign Het
Ctsq C T 13: 61,038,771 V140M probably damaging Het
Cyp4f18 A G 8: 72,001,082 probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Dsg3 G A 18: 20,538,499 G754R probably damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Fpr2 A G 17: 17,893,549 K269R probably benign Het
Frk T G 10: 34,584,056 L216V probably benign Het
Gan G A 8: 117,194,134 V370M probably damaging Het
Grik1 A G 16: 88,006,449 I285T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Kbtbd8 T A 6: 95,126,584 Y405N probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif26a T A 12: 112,176,890 S1193T probably benign Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Lrrk1 G T 7: 66,294,903 T653K possibly damaging Het
Meiob A G 17: 24,827,948 Y182C probably benign Het
Myh6 T C 14: 54,956,955 D739G probably benign Het
Ninl T C 2: 150,980,119 D21G probably damaging Het
Olfr1504 C T 19: 13,887,706 C168Y probably damaging Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pacsin2 A C 15: 83,379,055 V125G probably damaging Het
Pfas G A 11: 68,988,286 probably benign Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Prkd1 A T 12: 50,388,426 V506E possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Ryr2 T A 13: 11,738,209 D1742V possibly damaging Het
Szt2 G A 4: 118,378,269 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Xrcc6 A G 15: 82,029,571 T378A probably benign Het
Other mutations in Endod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Endod1 APN 9 14356753 missense possibly damaging 0.93
IGL01302:Endod1 APN 9 14357239 missense possibly damaging 0.50
IGL02895:Endod1 APN 9 14356870 missense probably benign 0.06
IGL02994:Endod1 APN 9 14356887 missense possibly damaging 0.93
IGL03120:Endod1 APN 9 14357035 missense probably damaging 0.98
royal_gorge UTSW 9 14356870 missense probably benign 0.06
R0745:Endod1 UTSW 9 14357117 missense possibly damaging 0.92
R1087:Endod1 UTSW 9 14357193 missense possibly damaging 0.69
R1829:Endod1 UTSW 9 14356926 missense probably damaging 1.00
R1857:Endod1 UTSW 9 14357109 missense probably benign 0.05
R2120:Endod1 UTSW 9 14357653 missense probably benign 0.07
R4801:Endod1 UTSW 9 14357023 missense probably benign 0.05
R4802:Endod1 UTSW 9 14357023 missense probably benign 0.05
R5017:Endod1 UTSW 9 14356891 nonsense probably null
R6027:Endod1 UTSW 9 14357597 nonsense probably null
R6179:Endod1 UTSW 9 14357461 missense probably benign 0.00
R6279:Endod1 UTSW 9 14356870 missense probably benign 0.06
R6300:Endod1 UTSW 9 14356870 missense probably benign 0.06
R6986:Endod1 UTSW 9 14357310 missense probably damaging 1.00
R7314:Endod1 UTSW 9 14356999 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GTTCATGTTCTCTACTACCCAGGAAAC -3'
(R):5'- TGAGCACTGCAGCCATCTTC -3'

Sequencing Primer
(F):5'- CAGACACTGCAGACGTCTGAG -3'
(R):5'- AGCCATCTTCGGGGTGGAG -3'
Posted On2015-04-17