Incidental Mutation 'R4990:Hnrnpr'
ID386117
Institutional Source Beutler Lab
Gene Symbol Hnrnpr
Ensembl Gene ENSMUSG00000066037
Gene Nameheterogeneous nuclear ribonucleoprotein R
SynonymshnRNPR, Hnrpr, 2610528B01Rik, 2610003J05Rik
MMRRC Submission 042584-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4990 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location136310942-136359447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 136336298 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 239 (V239I)
Ref Sequence ENSEMBL: ENSMUSP00000138263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084219] [ENSMUST00000105850] [ENSMUST00000131671] [ENSMUST00000148843]
Predicted Effect probably damaging
Transcript: ENSMUST00000084219
AA Change: V239I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081239
Gene: ENSMUSG00000066037
AA Change: V239I

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105850
AA Change: V340I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101476
Gene: ENSMUSG00000066037
AA Change: V340I

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131671
AA Change: V239I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138263
Gene: ENSMUSG00000066037
AA Change: V239I

DomainStartEndE-ValueType
RRM 65 139 1.27e-16 SMART
RRM 146 223 9.42e-11 SMART
RRM 241 306 3.76e-19 SMART
low complexity region 318 327 N/A INTRINSIC
low complexity region 332 395 N/A INTRINSIC
low complexity region 398 426 N/A INTRINSIC
low complexity region 430 473 N/A INTRINSIC
low complexity region 503 519 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148843
AA Change: V340I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138399
Gene: ENSMUSG00000066037
AA Change: V340I

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182327
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is a member of the spliceosome C complex, which functions in pre-mRNA processing and transport. The encoded protein also promotes transcription at the c-fos gene. Alternative splicing results in multiple transcript variants. There are pseudogenes for this gene on chromosomes 4, 11, and 10. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,294,939 I1135V possibly damaging Het
Abca14 G A 7: 120,312,165 R1324K probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Aplnr G A 2: 85,137,377 V249M probably damaging Het
Atg16l1 A G 1: 87,789,369 K471R probably benign Het
Cacna1b A G 2: 24,678,874 probably null Het
Ccdc152 A G 15: 3,301,157 I12T probably benign Het
Cds1 A G 5: 101,798,379 Y148C probably damaging Het
Cenpe T A 3: 135,256,640 L1989Q probably damaging Het
Cep295 T C 9: 15,332,138 Q1674R probably damaging Het
D930020B18Rik C G 10: 121,654,761 P89A probably damaging Het
D930020B18Rik C T 10: 121,654,762 P89L probably damaging Het
Dock2 T C 11: 34,695,251 M535V probably damaging Het
Dscam A G 16: 96,825,515 V398A probably benign Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Emb T A 13: 117,264,510 N198K probably damaging Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Fbxw18 T C 9: 109,688,393 E414G probably damaging Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm5861 A T 5: 11,186,414 E138V probably damaging Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Ipo11 A T 13: 106,860,887 I688K probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Kcnh7 T C 2: 62,734,288 N876D probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lrp2 G T 2: 69,481,388 T2582K probably benign Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Megf6 A G 4: 154,267,226 E1132G possibly damaging Het
Mesp1 A G 7: 79,792,921 Y203H probably damaging Het
Ms4a4a T C 19: 11,378,837 S29P probably benign Het
Nbeal2 A C 9: 110,634,803 C1174G probably benign Het
Neb C T 2: 52,255,546 V2989I probably benign Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Nt5e A G 9: 88,355,593 N192S probably benign Het
Ntng1 A T 3: 110,135,261 probably null Het
Olfr1215 A T 2: 89,001,472 I272K probably damaging Het
Olfr1229 A T 2: 89,283,327 probably null Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Olfr45 G A 7: 140,691,447 E181K probably damaging Het
Panx1 A G 9: 15,010,217 Y121H probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Pgm3 T A 9: 86,558,412 I409F probably damaging Het
Plg T C 17: 12,411,510 Y645H probably benign Het
Pon3 T C 6: 5,221,619 H337R probably benign Het
Rasa2 A G 9: 96,591,989 I162T probably benign Het
Ror1 A G 4: 100,441,964 I845V probably benign Het
Rpl4 T C 9: 64,174,885 V22A probably benign Het
Ryr3 G T 2: 112,635,777 Q4746K probably damaging Het
Ryr3 T C 2: 112,909,973 N531S probably damaging Het
Sbno1 A T 5: 124,400,165 F571I probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sec22b T G 3: 97,921,111 probably null Het
Slc45a2 A G 15: 11,001,150 M112V probably benign Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Trappc11 A T 8: 47,490,895 D1127E probably benign Het
Triobp C A 15: 78,967,005 A453D probably benign Het
Tubd1 T C 11: 86,557,839 L295P probably damaging Het
Ulk4 C T 9: 121,192,786 V620I probably benign Het
Vmn2r39 A G 7: 9,023,676 I442T probably benign Het
Wwc1 T C 11: 35,876,566 T413A probably benign Het
Zfp131 A C 13: 119,782,913 V77G probably damaging Het
Zfyve26 T C 12: 79,287,833 D137G probably damaging Het
Other mutations in Hnrnpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Hnrnpr APN 4 136339545 missense unknown
IGL00844:Hnrnpr APN 4 136339205 missense probably benign 0.17
IGL01374:Hnrnpr APN 4 136327418 splice site probably benign
IGL01704:Hnrnpr APN 4 136329381 missense possibly damaging 0.89
IGL01825:Hnrnpr APN 4 136339539 nonsense probably null
IGL01843:Hnrnpr APN 4 136339413 splice site probably benign
IGL01871:Hnrnpr APN 4 136339574 missense unknown
IGL02376:Hnrnpr APN 4 136319455 missense probably damaging 1.00
IGL02557:Hnrnpr APN 4 136319506 missense probably damaging 1.00
IGL02947:Hnrnpr APN 4 136316379 missense probably damaging 1.00
PIT4677001:Hnrnpr UTSW 4 136329439 missense probably damaging 1.00
R0142:Hnrnpr UTSW 4 136327282 missense probably damaging 1.00
R0219:Hnrnpr UTSW 4 136339163 splice site probably benign
R1459:Hnrnpr UTSW 4 136329444 missense probably damaging 1.00
R1917:Hnrnpr UTSW 4 136332488 nonsense probably null
R2007:Hnrnpr UTSW 4 136319513 unclassified probably benign
R2364:Hnrnpr UTSW 4 136327329 missense possibly damaging 0.69
R3788:Hnrnpr UTSW 4 136336313 missense probably damaging 1.00
R4066:Hnrnpr UTSW 4 136339346 intron probably benign
R4232:Hnrnpr UTSW 4 136339189 missense probably benign 0.15
R4433:Hnrnpr UTSW 4 136317148 missense probably benign 0.04
R4664:Hnrnpr UTSW 4 136317175 unclassified probably benign
R4990:Hnrnpr UTSW 4 136329379 missense probably damaging 1.00
R5058:Hnrnpr UTSW 4 136336337 missense possibly damaging 0.89
R5328:Hnrnpr UTSW 4 136339216 missense probably benign 0.01
R5469:Hnrnpr UTSW 4 136319434 missense probably damaging 1.00
R5641:Hnrnpr UTSW 4 136332487 missense probably damaging 0.97
R7067:Hnrnpr UTSW 4 136327393 missense probably damaging 1.00
R7250:Hnrnpr UTSW 4 136332435 missense probably benign 0.45
R7254:Hnrnpr UTSW 4 136332575 missense possibly damaging 0.92
R8213:Hnrnpr UTSW 4 136317175 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGGTAACTGTTCCCTTGGGAC -3'
(R):5'- CTAGGTTCAGACTCCAGCAAC -3'

Sequencing Primer
(F):5'- TGGGACAAAAGGCAAGAGC -3'
(R):5'- CTGCAGCTCTAGAGAATCCAGTG -3'
Posted On2016-05-10