Incidental Mutation 'R4990:Abca12'
ID386096
Institutional Source Beutler Lab
Gene Symbol Abca12
Ensembl Gene ENSMUSG00000050296
Gene NameATP-binding cassette, sub-family A (ABC1), member 12
Synonyms4833417A11Rik, 4832428G11Rik
MMRRC Submission 042584-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4990 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location71242276-71414910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71294939 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1135 (I1135V)
Ref Sequence ENSEMBL: ENSMUSP00000084523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087268]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087268
AA Change: I1135V

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084523
Gene: ENSMUSG00000050296
AA Change: I1135V

DomainStartEndE-ValueType
transmembrane domain 24 43 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
Pfam:ABC2_membrane_3 885 1267 2.9e-24 PFAM
AAA 1370 1554 4.2e-10 SMART
low complexity region 1717 1735 N/A INTRINSIC
Pfam:ABC2_membrane_3 1744 2206 9.6e-35 PFAM
AAA 2282 2467 4.61e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188752
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily, which is the only major ABC subfamily found exclusively in multicellular eukaryotes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with defective skin development and abnormal lung morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,312,165 R1324K probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Aplnr G A 2: 85,137,377 V249M probably damaging Het
Atg16l1 A G 1: 87,789,369 K471R probably benign Het
Cacna1b A G 2: 24,678,874 probably null Het
Ccdc152 A G 15: 3,301,157 I12T probably benign Het
Cds1 A G 5: 101,798,379 Y148C probably damaging Het
Cenpe T A 3: 135,256,640 L1989Q probably damaging Het
Cep295 T C 9: 15,332,138 Q1674R probably damaging Het
D930020B18Rik C G 10: 121,654,761 P89A probably damaging Het
D930020B18Rik C T 10: 121,654,762 P89L probably damaging Het
Dock2 T C 11: 34,695,251 M535V probably damaging Het
Dscam A G 16: 96,825,515 V398A probably benign Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Emb T A 13: 117,264,510 N198K probably damaging Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Fbxw18 T C 9: 109,688,393 E414G probably damaging Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm5861 A T 5: 11,186,414 E138V probably damaging Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hnrnpr A G 4: 136,329,379 E230G probably damaging Het
Hnrnpr G A 4: 136,336,298 V239I probably damaging Het
Ipo11 A T 13: 106,860,887 I688K probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Kcnh7 T C 2: 62,734,288 N876D probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lrp2 G T 2: 69,481,388 T2582K probably benign Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Megf6 A G 4: 154,267,226 E1132G possibly damaging Het
Mesp1 A G 7: 79,792,921 Y203H probably damaging Het
Ms4a4a T C 19: 11,378,837 S29P probably benign Het
Nbeal2 A C 9: 110,634,803 C1174G probably benign Het
Neb C T 2: 52,255,546 V2989I probably benign Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Nt5e A G 9: 88,355,593 N192S probably benign Het
Ntng1 A T 3: 110,135,261 probably null Het
Olfr1215 A T 2: 89,001,472 I272K probably damaging Het
Olfr1229 A T 2: 89,283,327 probably null Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Olfr45 G A 7: 140,691,447 E181K probably damaging Het
Panx1 A G 9: 15,010,217 Y121H probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Pgm3 T A 9: 86,558,412 I409F probably damaging Het
Plg T C 17: 12,411,510 Y645H probably benign Het
Pon3 T C 6: 5,221,619 H337R probably benign Het
Rasa2 A G 9: 96,591,989 I162T probably benign Het
Ror1 A G 4: 100,441,964 I845V probably benign Het
Rpl4 T C 9: 64,174,885 V22A probably benign Het
Ryr3 G T 2: 112,635,777 Q4746K probably damaging Het
Ryr3 T C 2: 112,909,973 N531S probably damaging Het
Sbno1 A T 5: 124,400,165 F571I probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sec22b T G 3: 97,921,111 probably null Het
Slc45a2 A G 15: 11,001,150 M112V probably benign Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Trappc11 A T 8: 47,490,895 D1127E probably benign Het
Triobp C A 15: 78,967,005 A453D probably benign Het
Tubd1 T C 11: 86,557,839 L295P probably damaging Het
Ulk4 C T 9: 121,192,786 V620I probably benign Het
Vmn2r39 A G 7: 9,023,676 I442T probably benign Het
Wwc1 T C 11: 35,876,566 T413A probably benign Het
Zfp131 A C 13: 119,782,913 V77G probably damaging Het
Zfyve26 T C 12: 79,287,833 D137G probably damaging Het
Other mutations in Abca12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca12 APN 1 71303541 missense possibly damaging 0.64
IGL00556:Abca12 APN 1 71353757 missense probably benign 0.00
IGL00813:Abca12 APN 1 71353762 critical splice acceptor site probably null
IGL00835:Abca12 APN 1 71302733 missense probably damaging 1.00
IGL00921:Abca12 APN 1 71285729 missense probably damaging 1.00
IGL01011:Abca12 APN 1 71263632 missense probably benign 0.02
IGL01066:Abca12 APN 1 71353730 missense possibly damaging 0.95
IGL01082:Abca12 APN 1 71314114 missense probably damaging 1.00
IGL01310:Abca12 APN 1 71284156 missense probably benign 0.00
IGL01360:Abca12 APN 1 71286489 missense possibly damaging 0.95
IGL01585:Abca12 APN 1 71319886 missense probably benign 0.00
IGL01608:Abca12 APN 1 71259442 missense probably damaging 1.00
IGL01687:Abca12 APN 1 71267610 splice site probably benign
IGL01700:Abca12 APN 1 71280390 missense probably benign
IGL01723:Abca12 APN 1 71314168 missense probably benign 0.01
IGL01804:Abca12 APN 1 71276183 missense probably benign 0.01
IGL01982:Abca12 APN 1 71346698 missense probably benign 0.34
IGL02136:Abca12 APN 1 71247142 missense probably damaging 1.00
IGL02172:Abca12 APN 1 71302658 missense probably benign 0.09
IGL02222:Abca12 APN 1 71282886 missense probably benign 0.40
IGL02266:Abca12 APN 1 71268201 nonsense probably null
IGL02449:Abca12 APN 1 71401749 splice site probably null
IGL02471:Abca12 APN 1 71258198 missense probably benign 0.00
IGL02496:Abca12 APN 1 71288553 missense possibly damaging 0.55
IGL02552:Abca12 APN 1 71294747 missense probably damaging 0.96
IGL02795:Abca12 APN 1 71288748 missense probably damaging 1.00
IGL03000:Abca12 APN 1 71321800 missense probably benign 0.01
IGL03031:Abca12 APN 1 71314024 missense probably benign 0.00
IGL03131:Abca12 APN 1 71346702 missense probably benign
IGL03260:Abca12 APN 1 71284099 missense probably damaging 1.00
IGL03324:Abca12 APN 1 71314008 missense probably benign
IGL03408:Abca12 APN 1 71264795 missense probably damaging 1.00
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0121:Abca12 UTSW 1 71259786 splice site probably null
R0172:Abca12 UTSW 1 71279402 missense probably damaging 0.99
R0196:Abca12 UTSW 1 71259813 missense possibly damaging 0.81
R0400:Abca12 UTSW 1 71259776 splice site probably benign
R0466:Abca12 UTSW 1 71302663 missense probably damaging 1.00
R0616:Abca12 UTSW 1 71302671 missense probably damaging 1.00
R0668:Abca12 UTSW 1 71263614 missense probably damaging 1.00
R0928:Abca12 UTSW 1 71349174 missense probably benign 0.06
R1036:Abca12 UTSW 1 71263410 critical splice donor site probably null
R1086:Abca12 UTSW 1 71295061 splice site probably benign
R1300:Abca12 UTSW 1 71244808 missense probably damaging 1.00
R1337:Abca12 UTSW 1 71294819 missense probably benign 0.03
R1356:Abca12 UTSW 1 71302953 splice site probably benign
R1372:Abca12 UTSW 1 71294857 missense probably damaging 1.00
R1434:Abca12 UTSW 1 71309800 missense probably benign 0.00
R1580:Abca12 UTSW 1 71265965 missense possibly damaging 0.65
R1675:Abca12 UTSW 1 71263411 critical splice donor site probably null
R1773:Abca12 UTSW 1 71288596 missense probably damaging 1.00
R1829:Abca12 UTSW 1 71295029 missense probably benign 0.26
R1922:Abca12 UTSW 1 71319924 missense probably benign 0.10
R1927:Abca12 UTSW 1 71244840 missense probably damaging 1.00
R2115:Abca12 UTSW 1 71244771 missense probably benign 0.01
R2146:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2148:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2149:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2150:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2299:Abca12 UTSW 1 71258222 missense probably damaging 1.00
R2392:Abca12 UTSW 1 71258105 missense probably damaging 1.00
R2571:Abca12 UTSW 1 71249885 missense probably benign 0.00
R3077:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3078:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3705:Abca12 UTSW 1 71285705 missense probably damaging 1.00
R3800:Abca12 UTSW 1 71265887 missense probably damaging 1.00
R3905:Abca12 UTSW 1 71268230 missense possibly damaging 0.79
R3905:Abca12 UTSW 1 71279457 missense probably benign 0.02
R3962:Abca12 UTSW 1 71274515 splice site probably null
R4082:Abca12 UTSW 1 71267463 missense possibly damaging 0.64
R4131:Abca12 UTSW 1 71319871 critical splice donor site probably null
R4214:Abca12 UTSW 1 71288697 missense probably damaging 0.99
R4403:Abca12 UTSW 1 71267436 missense probably damaging 1.00
R4524:Abca12 UTSW 1 71302917 missense probably benign 0.19
R4615:Abca12 UTSW 1 71330334 missense probably benign
R4617:Abca12 UTSW 1 71330334 missense probably benign
R4714:Abca12 UTSW 1 71321450 missense probably benign 0.00
R4809:Abca12 UTSW 1 71278856 missense probably benign 0.10
R4810:Abca12 UTSW 1 71303612 missense probably benign 0.00
R4825:Abca12 UTSW 1 71302685 missense possibly damaging 0.70
R5013:Abca12 UTSW 1 71264767 missense probably damaging 0.99
R5026:Abca12 UTSW 1 71317224 missense probably benign 0.04
R5064:Abca12 UTSW 1 71300960 missense probably damaging 1.00
R5188:Abca12 UTSW 1 71291492 missense probably benign 0.23
R5234:Abca12 UTSW 1 71263664 missense probably damaging 0.99
R5267:Abca12 UTSW 1 71335774 splice site probably benign
R5302:Abca12 UTSW 1 71283952 missense possibly damaging 0.91
R5441:Abca12 UTSW 1 71295056 missense probably damaging 1.00
R5451:Abca12 UTSW 1 71294917 missense possibly damaging 0.94
R5526:Abca12 UTSW 1 71292446 missense probably benign 0.29
R5529:Abca12 UTSW 1 71264881 missense probably damaging 1.00
R5615:Abca12 UTSW 1 71307059 missense probably damaging 1.00
R5649:Abca12 UTSW 1 71291342 missense probably damaging 1.00
R5800:Abca12 UTSW 1 71321432 missense possibly damaging 0.78
R5807:Abca12 UTSW 1 71303492 missense probably damaging 1.00
R5878:Abca12 UTSW 1 71346633 missense possibly damaging 0.79
R5987:Abca12 UTSW 1 71258098 missense probably damaging 1.00
R6280:Abca12 UTSW 1 71272460 missense probably benign 0.04
R6316:Abca12 UTSW 1 71313959 missense probably benign 0.01
R6337:Abca12 UTSW 1 71295013 missense probably damaging 1.00
R6383:Abca12 UTSW 1 71247184 missense probably benign 0.03
R6564:Abca12 UTSW 1 71309850 missense possibly damaging 0.57
R6582:Abca12 UTSW 1 71258225 missense probably benign 0.00
R6756:Abca12 UTSW 1 71259353 splice site probably null
R6876:Abca12 UTSW 1 71263508 missense probably damaging 0.98
R6999:Abca12 UTSW 1 71317162 nonsense probably null
R7145:Abca12 UTSW 1 71307053 missense possibly damaging 0.92
R7272:Abca12 UTSW 1 71248432 missense probably damaging 0.99
R7285:Abca12 UTSW 1 71349155 nonsense probably null
R7421:Abca12 UTSW 1 71247136 nonsense probably null
R7531:Abca12 UTSW 1 71247173 missense probably damaging 0.99
R7592:Abca12 UTSW 1 71288677 missense probably benign 0.01
R7687:Abca12 UTSW 1 71258182 missense probably benign 0.00
R7690:Abca12 UTSW 1 71314154 missense probably benign 0.00
R7709:Abca12 UTSW 1 71335728 missense probably benign 0.00
X0013:Abca12 UTSW 1 71248433 missense probably damaging 0.99
X0018:Abca12 UTSW 1 71314510 missense probably benign
X0063:Abca12 UTSW 1 71349064 missense probably benign 0.15
X0065:Abca12 UTSW 1 71341461 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGCCGGTTGACTTACCATG -3'
(R):5'- ATCGTTACTTGGGTATCAGCCG -3'

Sequencing Primer
(F):5'- GCCGGTTGACTTACCATGAATAC -3'
(R):5'- TTACTTGGGTATCAGCCGAAGAAAC -3'
Posted On2016-05-10