Incidental Mutation 'R5023:Cd163'
ID391111
Institutional Source Beutler Lab
Gene Symbol Cd163
Ensembl Gene ENSMUSG00000008845
Gene NameCD163 antigen
Synonyms
MMRRC Submission 042614-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5023 (G1)
Quality Score214
Status Validated
Chromosome6
Chromosomal Location124304656-124330527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124325288 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 937 (T937I)
Ref Sequence ENSEMBL: ENSMUSP00000108160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032234] [ENSMUST00000112541]
Predicted Effect probably damaging
Transcript: ENSMUST00000032234
AA Change: T937I

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032234
Gene: ENSMUSG00000008845
AA Change: T937I

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SR 50 150 1.1e-52 SMART
SR 157 258 1.4e-55 SMART
SR 265 365 7.3e-60 SMART
SR 372 472 1.2e-35 SMART
SR 477 577 2.3e-41 SMART
SR 582 682 9.8e-39 SMART
SR 719 819 1.1e-60 SMART
SR 824 927 4e-24 SMART
SR 930 1030 2.3e-55 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112541
AA Change: T937I

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108160
Gene: ENSMUSG00000008845
AA Change: T937I

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
SR 50 150 2.26e-50 SMART
SR 157 258 3.11e-53 SMART
SR 265 365 1.54e-57 SMART
SR 372 472 2.64e-33 SMART
SR 477 577 5.03e-39 SMART
SR 582 682 2.09e-36 SMART
SR 719 819 2.38e-58 SMART
SR 824 927 8.93e-22 SMART
SR 930 1030 5.06e-53 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203210
Meta Mutation Damage Score 0.3275 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (127/129)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: After hindlimb ischemia, mice homozygous for a knock-out allele exhibit increased muscle satellite cell proliferation, and enhanced skeletal muscle regeneration not limited to the site of injury. Knock-out mice also exhibit increased eosinophilic airway inflammation in house dust mite-challenged. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 124 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,166,755 H739Q probably benign Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Abca8b A G 11: 109,974,988 probably null Het
Adam1b C T 5: 121,501,159 V608M probably damaging Het
Ank2 A G 3: 126,941,871 probably benign Het
Ankrd17 A C 5: 90,282,868 L1019R probably damaging Het
Arih1 T C 9: 59,486,232 N39S unknown Het
Best3 G A 10: 116,988,742 V38I probably benign Het
Bicc1 A G 10: 70,947,883 S393P possibly damaging Het
C1d T A 11: 17,266,674 N135K probably benign Het
Cage1 G T 13: 38,011,411 S778* probably null Het
Capn7 T A 14: 31,352,426 V262E probably damaging Het
Ccdc190 A G 1: 169,933,087 R95G probably damaging Het
Cdh18 G A 15: 23,259,666 S194N probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Ctsw T A 19: 5,466,049 D237V probably damaging Het
Cyp2c68 G A 19: 39,712,507 T289I probably benign Het
Cyp4f39 A G 17: 32,481,104 Y133C probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Dnah7a C A 1: 53,647,248 E248* probably null Het
Eef2kmt T A 16: 5,247,599 D248V probably damaging Het
Ewsr1 T C 11: 5,088,054 T113A possibly damaging Het
Fbxo4 A G 15: 3,977,756 probably null Het
Fbxo43 A T 15: 36,162,929 M44K probably benign Het
Fchsd1 A G 18: 37,964,810 I340T possibly damaging Het
Fgf5 C A 5: 98,262,015 A141E probably damaging Het
Gfm1 T C 3: 67,473,544 V664A probably damaging Het
Glp2r T C 11: 67,741,032 T121A possibly damaging Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm12169 T A 11: 46,528,532 D58E probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm15455 T C 1: 33,837,351 noncoding transcript Het
Gm1818 G C 12: 48,555,535 noncoding transcript Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5155 A T 7: 17,902,706 D236V probably damaging Het
Gm7030 A G 17: 36,109,415 probably benign Het
Gnb2 G A 5: 137,529,940 probably null Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpx5 C T 13: 21,288,745 V140I probably damaging Het
Gtpbp1 A T 15: 79,719,221 Q637L possibly damaging Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hhat A T 1: 192,727,339 L138Q probably damaging Het
Hipk1 G T 3: 103,777,507 T264N probably damaging Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Hnf4g G T 3: 3,644,587 A144S probably damaging Het
Hook3 TAGAG TAG 8: 26,032,019 probably null Het
Ifi204 G A 1: 173,751,740 T513I possibly damaging Het
Ino80b G T 6: 83,125,042 S26R probably damaging Het
Ints9 T A 14: 64,980,228 L68H probably damaging Het
Isx C T 8: 74,892,714 T178I probably benign Het
Kel A G 6: 41,688,111 L255P probably damaging Het
Klf11 T A 12: 24,655,359 S271T probably benign Het
Klhl20 A C 1: 161,109,220 probably null Het
Lama2 G A 10: 27,190,504 T1127I probably damaging Het
Larp1b T A 3: 41,033,985 N81K possibly damaging Het
Lsm11 T C 11: 45,944,839 D25G probably damaging Het
Map3k20 T A 2: 72,402,345 probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Milr1 A G 11: 106,766,965 D131G possibly damaging Het
Mybpc1 T G 10: 88,543,774 D635A probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Ndufa7 A G 17: 33,824,603 probably benign Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Neo1 T C 9: 58,990,271 D134G probably damaging Het
Nme4 G A 17: 26,093,668 T129I probably benign Het
Npffr2 A T 5: 89,582,687 T159S probably benign Het
Nup153 A T 13: 46,681,109 probably benign Het
Olfr139 T A 11: 74,045,055 D73V probably damaging Het
Olfr616 A C 7: 103,565,171 M36R possibly damaging Het
Pate2 T C 9: 35,686,111 probably benign Het
Pcca A G 14: 122,790,398 N73D probably damaging Het
Pip5k1c G A 10: 81,310,889 probably null Het
Pkhd1l1 A T 15: 44,528,191 H1551L probably benign Het
Pkhd1l1 G A 15: 44,582,227 M3768I probably benign Het
Ppa2 A G 3: 133,370,434 M275V probably benign Het
Ptpn23 G A 9: 110,388,556 T744I probably benign Het
Ptprv A T 1: 135,124,506 noncoding transcript Het
Rad17 A T 13: 100,645,063 H75Q possibly damaging Het
Rbm44 T C 1: 91,169,098 probably null Het
Rbpj C T 5: 53,649,415 R201W probably damaging Het
Rbpjl C A 2: 164,410,289 L215I probably damaging Het
Ror1 A G 4: 100,425,932 E398G probably benign Het
Scamp3 T A 3: 89,182,293 probably benign Het
Selenot CATGTATG CATGTATGTATG 3: 58,588,453 probably null Het
Siglec15 A G 18: 78,048,675 C104R probably damaging Het
Sis T C 3: 72,934,122 I787V probably benign Het
Slc17a8 T C 10: 89,576,560 D521G probably benign Het
Slc7a10 T A 7: 35,197,355 M172K possibly damaging Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Slitrk3 T C 3: 73,050,648 T264A probably benign Het
Smg8 A C 11: 87,086,137 V206G probably damaging Het
Smg9 A G 7: 24,405,872 K137R possibly damaging Het
Srrm2 C A 17: 23,819,317 probably benign Het
Sult2a2 T A 7: 13,734,860 Y84N possibly damaging Het
Syngr2 A T 11: 117,812,510 I34F probably benign Het
Tank G A 2: 61,578,635 probably benign Het
Tead4 T C 6: 128,294,171 probably benign Het
Tex36 A T 7: 133,595,290 C33S probably benign Het
Timm21 C A 18: 84,949,414 V112L possibly damaging Het
Tmem240 T A 4: 155,739,674 L92Q probably damaging Het
Tmem268 C G 4: 63,568,540 S100C probably damaging Het
Tmod3 G A 9: 75,511,206 P183S probably damaging Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trim16 A T 11: 62,836,812 Y233F probably benign Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ttc3 A G 16: 94,429,359 E450G probably benign Het
Ttk A G 9: 83,863,541 D647G probably damaging Het
Ubash3b A G 9: 41,037,459 C187R possibly damaging Het
Vmn1r29 T A 6: 58,308,067 Y257* probably null Het
Vmn1r33 T C 6: 66,612,105 N155S probably benign Het
Vmn2r28 T A 7: 5,486,464 I459L probably benign Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Vwde T C 6: 13,192,642 I421V possibly damaging Het
Xiap T C X: 42,094,465 F23L probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Zbtb11 A G 16: 56,006,065 Y819C probably damaging Het
Zfp112 A G 7: 24,126,484 T624A probably damaging Het
Zfp592 A G 7: 81,024,347 D353G probably damaging Het
Zfp62 T A 11: 49,215,729 S216T probably damaging Het
Zfp677 A T 17: 21,397,794 H371L probably damaging Het
Zfp780b T C 7: 27,963,448 K561E possibly damaging Het
Zfp936 G A 7: 43,187,257 D31N probably damaging Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Zpbp C T 11: 11,415,248 E200K probably benign Het
Other mutations in Cd163
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Cd163 APN 6 124329101 splice site probably benign
IGL00755:Cd163 APN 6 124318657 missense possibly damaging 0.70
IGL01690:Cd163 APN 6 124307318 missense possibly damaging 0.89
IGL02101:Cd163 APN 6 124307287 nonsense probably null
IGL02733:Cd163 APN 6 124325341 missense probably damaging 1.00
IGL02801:Cd163 APN 6 124320529 missense probably benign 0.00
IGL02897:Cd163 APN 6 124325527 missense probably damaging 1.00
IGL03074:Cd163 APN 6 124317986 missense probably benign 0.00
IGL03283:Cd163 APN 6 124309199 missense possibly damaging 0.49
compass UTSW 6 124329086 makesense probably null
hottish UTSW 6 124309208 missense probably damaging 1.00
protractor UTSW 6 124311566 missense probably damaging 1.00
t-square UTSW 6 124325288 missense probably damaging 0.97
R0494:Cd163 UTSW 6 124311449 missense probably damaging 1.00
R0554:Cd163 UTSW 6 124312660 missense probably benign 0.03
R0622:Cd163 UTSW 6 124317352 missense probably damaging 1.00
R1004:Cd163 UTSW 6 124325347 missense probably damaging 1.00
R1061:Cd163 UTSW 6 124309169 missense probably benign 0.00
R1132:Cd163 UTSW 6 124309096 nonsense probably null
R1195:Cd163 UTSW 6 124325250 splice site probably benign
R1195:Cd163 UTSW 6 124325250 splice site probably benign
R1436:Cd163 UTSW 6 124327931 missense possibly damaging 0.47
R1463:Cd163 UTSW 6 124311447 missense probably damaging 1.00
R1532:Cd163 UTSW 6 124312730 missense possibly damaging 0.91
R1541:Cd163 UTSW 6 124327961 missense probably benign
R1654:Cd163 UTSW 6 124317581 missense probably damaging 1.00
R1717:Cd163 UTSW 6 124329588 utr 3 prime probably benign
R1744:Cd163 UTSW 6 124307028 missense possibly damaging 0.94
R2014:Cd163 UTSW 6 124325498 missense probably damaging 0.99
R2035:Cd163 UTSW 6 124320629 missense probably damaging 0.97
R2095:Cd163 UTSW 6 124317822 missense probably damaging 1.00
R2124:Cd163 UTSW 6 124318856 missense probably damaging 1.00
R2146:Cd163 UTSW 6 124309208 missense probably damaging 1.00
R2353:Cd163 UTSW 6 124319156 nonsense probably null
R3854:Cd163 UTSW 6 124311566 missense probably damaging 1.00
R4425:Cd163 UTSW 6 124327903 missense possibly damaging 0.94
R4631:Cd163 UTSW 6 124329086 makesense probably null
R4647:Cd163 UTSW 6 124320621 missense probably damaging 1.00
R4713:Cd163 UTSW 6 124317618 critical splice donor site probably null
R4803:Cd163 UTSW 6 124312430 missense probably damaging 0.99
R4996:Cd163 UTSW 6 124319147 missense probably benign 0.00
R5022:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5032:Cd163 UTSW 6 124311669 missense probably damaging 1.00
R5057:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5121:Cd163 UTSW 6 124317989 missense probably damaging 1.00
R5436:Cd163 UTSW 6 124327964 missense probably benign
R5453:Cd163 UTSW 6 124312541 missense probably damaging 1.00
R5723:Cd163 UTSW 6 124319063 missense probably benign 0.00
R5929:Cd163 UTSW 6 124326609 critical splice donor site probably null
R5943:Cd163 UTSW 6 124329602 makesense probably null
R5964:Cd163 UTSW 6 124326572 missense probably benign 0.01
R5966:Cd163 UTSW 6 124320636 nonsense probably null
R6279:Cd163 UTSW 6 124317991 nonsense probably null
R6300:Cd163 UTSW 6 124317991 nonsense probably null
R6499:Cd163 UTSW 6 124304744 missense probably benign 0.00
R6602:Cd163 UTSW 6 124311635 missense probably damaging 1.00
R6708:Cd163 UTSW 6 124309208 missense probably damaging 1.00
R6767:Cd163 UTSW 6 124304779 missense possibly damaging 0.56
R6979:Cd163 UTSW 6 124317986 missense probably benign 0.00
R6993:Cd163 UTSW 6 124317714 missense probably damaging 1.00
R7345:Cd163 UTSW 6 124318938 missense possibly damaging 0.52
R7382:Cd163 UTSW 6 124311312 splice site probably null
R7552:Cd163 UTSW 6 124307228 missense probably benign 0.08
R7829:Cd163 UTSW 6 124304779 missense probably benign 0.04
R8354:Cd163 UTSW 6 124328965 missense probably benign 0.43
R8454:Cd163 UTSW 6 124328965 missense probably benign 0.43
R8530:Cd163 UTSW 6 124318901 missense probably damaging 1.00
R8560:Cd163 UTSW 6 124317401 missense possibly damaging 0.86
Z1177:Cd163 UTSW 6 124317385 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CCGAGCCTTAGAAGAGAGGAGTG -3'
(R):5'- CCGCCTTTGCTACTAAAGAGTCC -3'

Sequencing Primer
(F):5'- ATGGCTGTTACTCTCTACAC -3'
(R):5'- CAGCTCAATCCAGGTTGTTG -3'
Posted On2016-06-06