Incidental Mutation 'R5110:Ttc8'
ID393813
Institutional Source Beutler Lab
Gene Symbol Ttc8
Ensembl Gene ENSMUSG00000021013
Gene Nametetratricopeptide repeat domain 8
SynonymsBBS8, 0610012F22Rik
MMRRC Submission 042698-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.504) question?
Stock #R5110 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location98920574-98983238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98942303 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 17 (M17T)
Ref Sequence ENSEMBL: ENSMUSP00000115828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079146] [ENSMUST00000085109] [ENSMUST00000132878]
Predicted Effect probably benign
Transcript: ENSMUST00000079146
AA Change: M77T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000078148
Gene: ENSMUSG00000021013
AA Change: M77T

DomainStartEndE-ValueType
Blast:TPR 4 37 5e-12 BLAST
TPR 225 258 2.35e-1 SMART
TPR 292 325 9.68e-3 SMART
Blast:TPR 326 359 3e-14 BLAST
TPR 360 393 2.26e-3 SMART
TPR 397 430 1.91e-1 SMART
TPR 431 464 1.81e-2 SMART
Blast:TPR 465 498 7e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000085109
AA Change: M67T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000082190
Gene: ENSMUSG00000021013
AA Change: M67T

DomainStartEndE-ValueType
Blast:TPR 4 37 4e-12 BLAST
TPR 215 248 2.35e-1 SMART
TPR 282 315 9.68e-3 SMART
Blast:TPR 316 349 3e-14 BLAST
TPR 350 383 2.26e-3 SMART
TPR 387 420 1.91e-1 SMART
TPR 421 454 1.81e-2 SMART
Blast:TPR 455 488 7e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124514
Predicted Effect probably benign
Transcript: ENSMUST00000132878
AA Change: M17T

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115828
Gene: ENSMUSG00000021013
AA Change: M17T

DomainStartEndE-ValueType
SCOP:d1a17__ 128 206 2e-5 SMART
Blast:TPR 165 198 8e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223023
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223356
Meta Mutation Damage Score 0.0912 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has been directly linked to Bardet-Biedl syndrome. The primary features of this syndrome include retinal dystrophy, obesity, polydactyly, renal abnormalities and learning disabilities. Experimentation in non-human eukaryotes suggests that this gene is expressed in ciliated cells and that it is involved in the formation of cilia. A mutation in this gene has also been implicated in nonsyndromic retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null mutation display partial postnatal lethality with slow postnatal weight gain, age related obesity, impaired olfation, loss of cilia from the olfactory epithelium, impaired targeting of olfactory sensory neuron axons, retinal degeneration, and mild renal tubule dilation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,295,357 probably null Het
2310016G11Rik G A 7: 44,677,862 noncoding transcript Het
Abi2 G A 1: 60,450,121 V98I probably benign Het
Adam21 T C 12: 81,560,215 T258A probably benign Het
Adam33 A T 2: 131,053,770 C542S probably damaging Het
Adamts15 A G 9: 30,921,444 V265A probably benign Het
Ahnak A T 19: 9,014,759 D4469V probably damaging Het
Aicda A G 6: 122,561,185 N101D probably benign Het
Als2 A T 1: 59,185,441 D1040E probably damaging Het
Car15 T C 16: 17,835,347 R319G possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col1a1 T C 11: 94,941,593 probably null Het
Col25a1 A G 3: 130,584,725 *594W probably null Het
Cwf19l2 A G 9: 3,450,012 probably null Het
Dctn4 C T 18: 60,546,315 P236S probably damaging Het
Ehmt1 C A 2: 24,852,790 C459F probably benign Het
Enox1 T C 14: 77,707,687 probably null Het
Fam136b-ps A G 15: 31,276,710 probably benign Het
Fzd1 T C 5: 4,756,448 D378G probably benign Het
Golga5 G A 12: 102,472,077 R17Q probably benign Het
Hk1 A T 10: 62,286,651 Y422N probably damaging Het
Hsf4 A G 8: 105,272,795 D255G probably benign Het
Ift81 A G 5: 122,551,058 V665A probably benign Het
Igkv13-84 T C 6: 68,939,608 F3L probably benign Het
Kcnh1 T A 1: 192,337,747 S433R possibly damaging Het
Ktn1 A G 14: 47,704,287 probably benign Het
Lrp4 A T 2: 91,497,072 D1471V possibly damaging Het
Macf1 A T 4: 123,368,008 D6990E probably damaging Het
Map3k6 G A 4: 133,247,548 probably benign Het
Miox T A 15: 89,335,556 D82E probably benign Het
Olfr722 T G 14: 49,895,575 I76L possibly damaging Het
Ovgp1 G C 3: 105,977,783 R133P probably damaging Het
Per2 G A 1: 91,429,515 T642I possibly damaging Het
Pparg T C 6: 115,473,003 V321A probably damaging Het
Pptc7 T A 5: 122,308,249 N17K probably benign Het
Prpf19 T C 19: 10,899,287 probably benign Het
Rai14 T C 15: 10,690,410 probably benign Het
Sardh T C 2: 27,189,547 D911G probably benign Het
Sbf2 T A 7: 110,364,657 T994S probably benign Het
Slc1a1 G A 19: 28,911,808 E494K probably benign Het
Smarcc1 A G 9: 110,197,784 K771E possibly damaging Het
St5 A G 7: 109,542,490 S556P probably benign Het
Stim1 T C 7: 102,268,422 V3A unknown Het
Syne3 G A 12: 104,943,370 R736C probably benign Het
Synj2 T C 17: 6,037,715 V986A probably benign Het
Tinag A G 9: 76,952,007 S440P probably damaging Het
Tshz2 A G 2: 169,884,197 T238A possibly damaging Het
Tubgcp5 G A 7: 55,808,637 R432Q probably damaging Het
Ugt1a10 T A 1: 88,056,252 probably null Het
Usp4 T A 9: 108,362,678 I202N probably damaging Het
Vmn1r194 T G 13: 22,245,000 S262R probably benign Het
Vmn2r101 T C 17: 19,611,635 F631S possibly damaging Het
Vps13b T A 15: 35,770,809 S2133T probably damaging Het
Zfp13 C A 17: 23,580,860 V77F probably benign Het
Zscan10 T A 17: 23,609,632 C306S probably damaging Het
Other mutations in Ttc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Ttc8 APN 12 98976018 missense probably damaging 0.96
IGL01139:Ttc8 APN 12 98964545 nonsense probably null
IGL02179:Ttc8 APN 12 98964537 missense possibly damaging 0.87
IGL02715:Ttc8 APN 12 98943920 splice site probably benign
IGL02958:Ttc8 APN 12 98964544 missense probably benign 0.03
IGL03249:Ttc8 APN 12 98943821 splice site probably benign
P0035:Ttc8 UTSW 12 98976416 splice site probably benign
R0606:Ttc8 UTSW 12 98943459 splice site probably benign
R1005:Ttc8 UTSW 12 98937144 missense probably benign 0.11
R1584:Ttc8 UTSW 12 98920764 missense probably benign 0.01
R1628:Ttc8 UTSW 12 98982521 missense probably benign 0.07
R1706:Ttc8 UTSW 12 98943883 missense probably benign 0.02
R4585:Ttc8 UTSW 12 98982530 missense probably benign
R4720:Ttc8 UTSW 12 98979809 missense possibly damaging 0.94
R4879:Ttc8 UTSW 12 98942303 missense possibly damaging 0.55
R6272:Ttc8 UTSW 12 98982494 missense possibly damaging 0.63
R6465:Ttc8 UTSW 12 98964570 missense probably damaging 1.00
R6620:Ttc8 UTSW 12 98957320 missense possibly damaging 0.95
R6708:Ttc8 UTSW 12 98943532 missense probably damaging 0.99
R6772:Ttc8 UTSW 12 98943589 missense probably damaging 1.00
R6901:Ttc8 UTSW 12 98961476 missense probably damaging 1.00
R7060:Ttc8 UTSW 12 98943467 missense probably benign
R7117:Ttc8 UTSW 12 98976502 missense possibly damaging 0.63
R7174:Ttc8 UTSW 12 98974701 missense possibly damaging 0.79
R7385:Ttc8 UTSW 12 98942288 missense possibly damaging 0.78
R7447:Ttc8 UTSW 12 98943872 missense probably damaging 0.97
R7589:Ttc8 UTSW 12 98976437 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACTTCCTTGACATCAGGG -3'
(R):5'- GACCAGCAAGCCACCATATATTATG -3'

Sequencing Primer
(F):5'- CCTTGACATCAGGGTCCTG -3'
(R):5'- ATATTATGGCCATTCTCTGATACCAC -3'
Posted On2016-06-15