Incidental Mutation 'R5110:Sardh'
ID393784
Institutional Source Beutler Lab
Gene Symbol Sardh
Ensembl Gene ENSMUSG00000009614
Gene Namesarcosine dehydrogenase
Synonyms
MMRRC Submission 042698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R5110 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location27188393-27248337 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27189547 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 911 (D911G)
Ref Sequence ENSEMBL: ENSMUSP00000099950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102886]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000091224
Predicted Effect probably benign
Transcript: ENSMUST00000102886
AA Change: D911G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099950
Gene: ENSMUSG00000009614
AA Change: D911G

DomainStartEndE-ValueType
Pfam:DAO 69 428 1.7e-63 PFAM
Pfam:FAO_M 431 486 9.2e-22 PFAM
Pfam:GCV_T 489 799 3.1e-64 PFAM
Pfam:GCV_T_C 807 904 4.7e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170435
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme localized to the mitochondrial matrix which catalyzes the oxidative demethylation of sarcosine. This enzyme is distinct from another mitochondrial matrix enzyme, dimethylglycine dehydrogenase, which catalyzes a reaction resulting in the formation of sarcosine. Mutations in this gene are associated with sarcosinemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,295,357 probably null Het
2310016G11Rik G A 7: 44,677,862 noncoding transcript Het
Abi2 G A 1: 60,450,121 V98I probably benign Het
Adam21 T C 12: 81,560,215 T258A probably benign Het
Adam33 A T 2: 131,053,770 C542S probably damaging Het
Adamts15 A G 9: 30,921,444 V265A probably benign Het
Ahnak A T 19: 9,014,759 D4469V probably damaging Het
Aicda A G 6: 122,561,185 N101D probably benign Het
Als2 A T 1: 59,185,441 D1040E probably damaging Het
Car15 T C 16: 17,835,347 R319G possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col1a1 T C 11: 94,941,593 probably null Het
Col25a1 A G 3: 130,584,725 *594W probably null Het
Cwf19l2 A G 9: 3,450,012 probably null Het
Dctn4 C T 18: 60,546,315 P236S probably damaging Het
Ehmt1 C A 2: 24,852,790 C459F probably benign Het
Enox1 T C 14: 77,707,687 probably null Het
Fam136b-ps A G 15: 31,276,710 probably benign Het
Fzd1 T C 5: 4,756,448 D378G probably benign Het
Golga5 G A 12: 102,472,077 R17Q probably benign Het
Hk1 A T 10: 62,286,651 Y422N probably damaging Het
Hsf4 A G 8: 105,272,795 D255G probably benign Het
Ift81 A G 5: 122,551,058 V665A probably benign Het
Igkv13-84 T C 6: 68,939,608 F3L probably benign Het
Kcnh1 T A 1: 192,337,747 S433R possibly damaging Het
Ktn1 A G 14: 47,704,287 probably benign Het
Lrp4 A T 2: 91,497,072 D1471V possibly damaging Het
Macf1 A T 4: 123,368,008 D6990E probably damaging Het
Map3k6 G A 4: 133,247,548 probably benign Het
Miox T A 15: 89,335,556 D82E probably benign Het
Olfr722 T G 14: 49,895,575 I76L possibly damaging Het
Ovgp1 G C 3: 105,977,783 R133P probably damaging Het
Per2 G A 1: 91,429,515 T642I possibly damaging Het
Pparg T C 6: 115,473,003 V321A probably damaging Het
Pptc7 T A 5: 122,308,249 N17K probably benign Het
Prpf19 T C 19: 10,899,287 probably benign Het
Rai14 T C 15: 10,690,410 probably benign Het
Sbf2 T A 7: 110,364,657 T994S probably benign Het
Slc1a1 G A 19: 28,911,808 E494K probably benign Het
Smarcc1 A G 9: 110,197,784 K771E possibly damaging Het
St5 A G 7: 109,542,490 S556P probably benign Het
Stim1 T C 7: 102,268,422 V3A unknown Het
Syne3 G A 12: 104,943,370 R736C probably benign Het
Synj2 T C 17: 6,037,715 V986A probably benign Het
Tinag A G 9: 76,952,007 S440P probably damaging Het
Tshz2 A G 2: 169,884,197 T238A possibly damaging Het
Ttc8 T C 12: 98,942,303 M17T probably benign Het
Tubgcp5 G A 7: 55,808,637 R432Q probably damaging Het
Ugt1a10 T A 1: 88,056,252 probably null Het
Usp4 T A 9: 108,362,678 I202N probably damaging Het
Vmn1r194 T G 13: 22,245,000 S262R probably benign Het
Vmn2r101 T C 17: 19,611,635 F631S possibly damaging Het
Vps13b T A 15: 35,770,809 S2133T probably damaging Het
Zfp13 C A 17: 23,580,860 V77F probably benign Het
Zscan10 T A 17: 23,609,632 C306S probably damaging Het
Other mutations in Sardh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Sardh APN 2 27215113 missense probably benign 0.07
IGL01686:Sardh APN 2 27189613 missense probably damaging 1.00
IGL01868:Sardh APN 2 27227147 missense probably benign 0.35
IGL02167:Sardh APN 2 27191975 missense probably damaging 0.98
IGL02272:Sardh APN 2 27224991 missense probably benign 0.00
IGL02870:Sardh APN 2 27235491 missense possibly damaging 0.93
IGL03117:Sardh APN 2 27239446 missense probably damaging 1.00
PIT4305001:Sardh UTSW 2 27228314 missense probably damaging 1.00
PIT4791001:Sardh UTSW 2 27197648 missense probably damaging 1.00
R0265:Sardh UTSW 2 27227066 splice site probably benign
R0781:Sardh UTSW 2 27191919 missense possibly damaging 0.82
R1110:Sardh UTSW 2 27191919 missense possibly damaging 0.82
R1242:Sardh UTSW 2 27235563 missense probably damaging 1.00
R1404:Sardh UTSW 2 27239461 missense probably damaging 1.00
R1404:Sardh UTSW 2 27239461 missense probably damaging 1.00
R1514:Sardh UTSW 2 27197690 missense possibly damaging 0.95
R1565:Sardh UTSW 2 27242719 missense probably damaging 1.00
R1832:Sardh UTSW 2 27235569 missense possibly damaging 0.95
R1836:Sardh UTSW 2 27215182 missense possibly damaging 0.65
R1997:Sardh UTSW 2 27244397 missense probably damaging 0.97
R2006:Sardh UTSW 2 27228339 missense probably damaging 1.00
R2046:Sardh UTSW 2 27215082 missense possibly damaging 0.95
R2242:Sardh UTSW 2 27235515 missense possibly damaging 0.93
R2897:Sardh UTSW 2 27189547 missense probably benign 0.00
R4332:Sardh UTSW 2 27215114 missense possibly damaging 0.85
R4807:Sardh UTSW 2 27189527 missense probably benign 0.00
R4841:Sardh UTSW 2 27191955 missense probably benign 0.09
R4842:Sardh UTSW 2 27191955 missense probably benign 0.09
R4856:Sardh UTSW 2 27244477 missense probably benign 0.02
R4936:Sardh UTSW 2 27228241 splice site probably null
R5089:Sardh UTSW 2 27239613 critical splice donor site probably null
R5257:Sardh UTSW 2 27244259 missense probably damaging 0.98
R5406:Sardh UTSW 2 27211084 missense possibly damaging 0.72
R5450:Sardh UTSW 2 27239698 missense possibly damaging 0.65
R5594:Sardh UTSW 2 27220723 missense probably damaging 1.00
R5870:Sardh UTSW 2 27220641 critical splice donor site probably null
R6014:Sardh UTSW 2 27197528 critical splice donor site probably null
R6021:Sardh UTSW 2 27189643 missense probably benign 0.44
R6470:Sardh UTSW 2 27244372 missense probably damaging 1.00
R6577:Sardh UTSW 2 27218855 missense possibly damaging 0.95
R6750:Sardh UTSW 2 27228257 missense probably benign 0.04
R7035:Sardh UTSW 2 27230842 missense probably damaging 1.00
R7162:Sardh UTSW 2 27197690 missense possibly damaging 0.95
R7256:Sardh UTSW 2 27218812 missense probably benign
R7692:Sardh UTSW 2 27197639 missense probably benign 0.01
R7709:Sardh UTSW 2 27241517 missense possibly damaging 0.62
R7884:Sardh UTSW 2 27239371 missense probably damaging 0.99
R7967:Sardh UTSW 2 27239371 missense probably damaging 0.99
X0011:Sardh UTSW 2 27242746 missense probably damaging 1.00
Z1176:Sardh UTSW 2 27196673 missense probably benign 0.08
Z1176:Sardh UTSW 2 27218834 missense possibly damaging 0.88
Z1176:Sardh UTSW 2 27218890 missense possibly damaging 0.52
Z1177:Sardh UTSW 2 27235513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCAAGACCACATGGAGGC -3'
(R):5'- TGTCTCAGAGAAGGCCTTGGTG -3'

Sequencing Primer
(F):5'- CCACATGGAGGCTAAGGGTG -3'
(R):5'- AAGGCCTTGGTGCGGGG -3'
Posted On2016-06-15