Incidental Mutation 'R5110:Tinag'
ID393807
Institutional Source Beutler Lab
Gene Symbol Tinag
Ensembl Gene ENSMUSG00000032357
Gene Nametubulointerstitial nephritis antigen
SynonymsTIN-ag
MMRRC Submission 042698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R5110 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location76951693-77045794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76952007 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 440 (S440P)
Ref Sequence ENSEMBL: ENSMUSP00000034911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034911] [ENSMUST00000184897]
Predicted Effect probably damaging
Transcript: ENSMUST00000034911
AA Change: S440P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034911
Gene: ENSMUSG00000032357
AA Change: S440P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SO 58 105 1.68e-11 SMART
Pept_C1 216 466 1.83e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184897
SMART Domains Protein: ENSMUSP00000139155
Gene: ENSMUSG00000032357

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SO 58 105 1.68e-11 SMART
Meta Mutation Damage Score 0.3525 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,295,357 probably null Het
2310016G11Rik G A 7: 44,677,862 noncoding transcript Het
Abi2 G A 1: 60,450,121 V98I probably benign Het
Adam21 T C 12: 81,560,215 T258A probably benign Het
Adam33 A T 2: 131,053,770 C542S probably damaging Het
Adamts15 A G 9: 30,921,444 V265A probably benign Het
Ahnak A T 19: 9,014,759 D4469V probably damaging Het
Aicda A G 6: 122,561,185 N101D probably benign Het
Als2 A T 1: 59,185,441 D1040E probably damaging Het
Car15 T C 16: 17,835,347 R319G possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col1a1 T C 11: 94,941,593 probably null Het
Col25a1 A G 3: 130,584,725 *594W probably null Het
Cwf19l2 A G 9: 3,450,012 probably null Het
Dctn4 C T 18: 60,546,315 P236S probably damaging Het
Ehmt1 C A 2: 24,852,790 C459F probably benign Het
Enox1 T C 14: 77,707,687 probably null Het
Fam136b-ps A G 15: 31,276,710 probably benign Het
Fzd1 T C 5: 4,756,448 D378G probably benign Het
Golga5 G A 12: 102,472,077 R17Q probably benign Het
Hk1 A T 10: 62,286,651 Y422N probably damaging Het
Hsf4 A G 8: 105,272,795 D255G probably benign Het
Ift81 A G 5: 122,551,058 V665A probably benign Het
Igkv13-84 T C 6: 68,939,608 F3L probably benign Het
Kcnh1 T A 1: 192,337,747 S433R possibly damaging Het
Ktn1 A G 14: 47,704,287 probably benign Het
Lrp4 A T 2: 91,497,072 D1471V possibly damaging Het
Macf1 A T 4: 123,368,008 D6990E probably damaging Het
Map3k6 G A 4: 133,247,548 probably benign Het
Miox T A 15: 89,335,556 D82E probably benign Het
Olfr722 T G 14: 49,895,575 I76L possibly damaging Het
Ovgp1 G C 3: 105,977,783 R133P probably damaging Het
Per2 G A 1: 91,429,515 T642I possibly damaging Het
Pparg T C 6: 115,473,003 V321A probably damaging Het
Pptc7 T A 5: 122,308,249 N17K probably benign Het
Prpf19 T C 19: 10,899,287 probably benign Het
Rai14 T C 15: 10,690,410 probably benign Het
Sardh T C 2: 27,189,547 D911G probably benign Het
Sbf2 T A 7: 110,364,657 T994S probably benign Het
Slc1a1 G A 19: 28,911,808 E494K probably benign Het
Smarcc1 A G 9: 110,197,784 K771E possibly damaging Het
St5 A G 7: 109,542,490 S556P probably benign Het
Stim1 T C 7: 102,268,422 V3A unknown Het
Syne3 G A 12: 104,943,370 R736C probably benign Het
Synj2 T C 17: 6,037,715 V986A probably benign Het
Tshz2 A G 2: 169,884,197 T238A possibly damaging Het
Ttc8 T C 12: 98,942,303 M17T probably benign Het
Tubgcp5 G A 7: 55,808,637 R432Q probably damaging Het
Ugt1a10 T A 1: 88,056,252 probably null Het
Usp4 T A 9: 108,362,678 I202N probably damaging Het
Vmn1r194 T G 13: 22,245,000 S262R probably benign Het
Vmn2r101 T C 17: 19,611,635 F631S possibly damaging Het
Vps13b T A 15: 35,770,809 S2133T probably damaging Het
Zfp13 C A 17: 23,580,860 V77F probably benign Het
Zscan10 T A 17: 23,609,632 C306S probably damaging Het
Other mutations in Tinag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01450:Tinag APN 9 77045576 missense possibly damaging 0.93
IGL01524:Tinag APN 9 77045538 missense probably damaging 1.00
IGL01537:Tinag APN 9 77045603 missense probably benign 0.01
IGL01832:Tinag APN 9 77031756 missense probably benign 0.18
IGL02512:Tinag APN 9 77031787 splice site probably benign
IGL02888:Tinag APN 9 77031713 missense probably benign 0.24
R0179:Tinag UTSW 9 76996882 splice site probably benign
R0200:Tinag UTSW 9 76951935 missense probably damaging 1.00
R0206:Tinag UTSW 9 76999852 missense probably damaging 1.00
R0545:Tinag UTSW 9 77031710 missense possibly damaging 0.61
R0666:Tinag UTSW 9 77005687 missense probably benign 0.02
R0685:Tinag UTSW 9 76952003 missense probably damaging 1.00
R0732:Tinag UTSW 9 77001654 missense possibly damaging 0.93
R1445:Tinag UTSW 9 77045516 missense probably damaging 1.00
R2318:Tinag UTSW 9 77045411 missense probably damaging 1.00
R3809:Tinag UTSW 9 76951905 missense probably benign 0.15
R4747:Tinag UTSW 9 76996956 missense probably benign
R4781:Tinag UTSW 9 76996950 missense possibly damaging 0.69
R5328:Tinag UTSW 9 77005631 nonsense probably null
R5605:Tinag UTSW 9 77045412 missense probably damaging 1.00
R5897:Tinag UTSW 9 77045444 missense probably damaging 1.00
R6296:Tinag UTSW 9 76996935 missense possibly damaging 0.67
R6822:Tinag UTSW 9 77031702 missense probably benign 0.00
R6915:Tinag UTSW 9 77001615 missense probably damaging 1.00
R7285:Tinag UTSW 9 77045661 missense probably benign
R7334:Tinag UTSW 9 77001649 missense probably damaging 1.00
Z1177:Tinag UTSW 9 77045498 missense not run
Predicted Primers PCR Primer
(F):5'- GGAACCTTGGATTGCTAAAATTCG -3'
(R):5'- TTGCCAGTGAATCCGTGCAG -3'

Sequencing Primer
(F):5'- CTGAACTTGTCAGTTGGC -3'
(R):5'- AATCCGTGCAGGGATATTAATGTG -3'
Posted On2016-06-15