Incidental Mutation 'R7589:Ttc8'
ID587315
Institutional Source Beutler Lab
Gene Symbol Ttc8
Ensembl Gene ENSMUSG00000021013
Gene Nametetratricopeptide repeat domain 8
SynonymsBBS8, 0610012F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.452) question?
Stock #R7589 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location98920574-98983238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98976437 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 412 (D412V)
Ref Sequence ENSEMBL: ENSMUSP00000078148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079146] [ENSMUST00000085109]
Predicted Effect probably damaging
Transcript: ENSMUST00000079146
AA Change: D412V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078148
Gene: ENSMUSG00000021013
AA Change: D412V

DomainStartEndE-ValueType
Blast:TPR 4 37 5e-12 BLAST
TPR 225 258 2.35e-1 SMART
TPR 292 325 9.68e-3 SMART
Blast:TPR 326 359 3e-14 BLAST
TPR 360 393 2.26e-3 SMART
TPR 397 430 1.91e-1 SMART
TPR 431 464 1.81e-2 SMART
Blast:TPR 465 498 7e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000085109
AA Change: D402V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082190
Gene: ENSMUSG00000021013
AA Change: D402V

DomainStartEndE-ValueType
Blast:TPR 4 37 4e-12 BLAST
TPR 215 248 2.35e-1 SMART
TPR 282 315 9.68e-3 SMART
Blast:TPR 316 349 3e-14 BLAST
TPR 350 383 2.26e-3 SMART
TPR 387 420 1.91e-1 SMART
TPR 421 454 1.81e-2 SMART
Blast:TPR 455 488 7e-14 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has been directly linked to Bardet-Biedl syndrome. The primary features of this syndrome include retinal dystrophy, obesity, polydactyly, renal abnormalities and learning disabilities. Experimentation in non-human eukaryotes suggests that this gene is expressed in ciliated cells and that it is involved in the formation of cilia. A mutation in this gene has also been implicated in nonsyndromic retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null mutation display partial postnatal lethality with slow postnatal weight gain, age related obesity, impaired olfation, loss of cilia from the olfactory epithelium, impaired targeting of olfactory sensory neuron axons, retinal degeneration, and mild renal tubule dilation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T G 7: 41,626,972 C700G probably damaging Het
4930486L24Rik T C 13: 60,842,933 K316E probably damaging Het
Akap6 A T 12: 53,142,063 K2087* probably null Het
Alpk2 A T 18: 65,300,073 H1320Q probably damaging Het
Aox1 A T 1: 58,041,484 R31W probably damaging Het
Asnsd1 G T 1: 53,347,967 A167E probably benign Het
Atg14 T C 14: 47,543,090 D409G probably benign Het
Atp13a3 T A 16: 30,344,615 E574D probably benign Het
Bicd1 A T 6: 149,513,667 Y626F possibly damaging Het
Cdc5l C T 17: 45,410,781 R521Q probably benign Het
Dglucy T C 12: 100,841,401 F160L probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fmo9 T A 1: 166,674,428 K209N possibly damaging Het
Gsdmc2 C A 15: 63,825,043 L426F probably damaging Het
Hip1 T C 5: 135,414,311 D956G probably benign Het
Kif28 C T 1: 179,731,400 V248I probably benign Het
Klk10 T C 7: 43,783,627 V149A probably benign Het
Krt40 G T 11: 99,540,157 N255K probably damaging Het
Map4k4 T A 1: 40,021,091 Y1013* probably null Het
Mcur1 T C 13: 43,551,625 Y185C probably damaging Het
Mzt1 T C 14: 99,036,512 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nkx1-2 T C 7: 132,599,475 I18V probably damaging Het
Ofcc1 T A 13: 40,255,484 Q155L probably benign Het
Olfr1239 A G 2: 89,418,380 V11A possibly damaging Het
Olfr1282 T C 2: 111,335,374 K235E probably damaging Het
Olfr1377 A T 11: 50,985,030 M110L probably damaging Het
Olfr1411 G A 1: 92,597,059 R180H probably benign Het
Olfr635 T C 7: 103,979,791 Y200H probably damaging Het
Prnp A G 2: 131,936,866 D146G probably benign Het
Rhbdf1 C T 11: 32,212,903 V455I probably benign Het
Rnf6 G A 5: 146,211,429 R260W possibly damaging Het
Rtl1 T C 12: 109,593,845 N520S possibly damaging Het
Setbp1 A T 18: 78,856,492 M1320K probably benign Het
Slc39a8 A G 3: 135,884,362 T338A probably damaging Het
Tcf4 A G 18: 69,682,819 *693W probably null Het
Ush2a G T 1: 188,542,849 A1840S probably benign Het
Vmn1r60 A T 7: 5,544,689 S137R Het
Vmn1r91 T A 7: 20,101,877 H240Q probably benign Het
Vmn2r107 A T 17: 20,375,372 H729L probably benign Het
Yme1l1 C T 2: 23,160,262 T35I probably benign Het
Zfp292 A G 4: 34,806,777 V2094A probably damaging Het
Zfp934 A T 13: 62,518,316 N202K Het
Other mutations in Ttc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Ttc8 APN 12 98976018 missense probably damaging 0.96
IGL01139:Ttc8 APN 12 98964545 nonsense probably null
IGL02179:Ttc8 APN 12 98964537 missense possibly damaging 0.87
IGL02715:Ttc8 APN 12 98943920 splice site probably benign
IGL02958:Ttc8 APN 12 98964544 missense probably benign 0.03
IGL03249:Ttc8 APN 12 98943821 splice site probably benign
P0035:Ttc8 UTSW 12 98976416 splice site probably benign
R0606:Ttc8 UTSW 12 98943459 splice site probably benign
R1005:Ttc8 UTSW 12 98937144 missense probably benign 0.11
R1584:Ttc8 UTSW 12 98920764 missense probably benign 0.01
R1628:Ttc8 UTSW 12 98982521 missense probably benign 0.07
R1706:Ttc8 UTSW 12 98943883 missense probably benign 0.02
R4585:Ttc8 UTSW 12 98982530 missense probably benign
R4720:Ttc8 UTSW 12 98979809 missense possibly damaging 0.94
R4879:Ttc8 UTSW 12 98942303 missense possibly damaging 0.55
R5110:Ttc8 UTSW 12 98942303 missense probably benign 0.25
R6272:Ttc8 UTSW 12 98982494 missense possibly damaging 0.63
R6465:Ttc8 UTSW 12 98964570 missense probably damaging 1.00
R6620:Ttc8 UTSW 12 98957320 missense possibly damaging 0.95
R6708:Ttc8 UTSW 12 98943532 missense probably damaging 0.99
R6772:Ttc8 UTSW 12 98943589 missense probably damaging 1.00
R6901:Ttc8 UTSW 12 98961476 missense probably damaging 1.00
R7060:Ttc8 UTSW 12 98943467 missense probably benign
R7117:Ttc8 UTSW 12 98976502 missense possibly damaging 0.63
R7174:Ttc8 UTSW 12 98974701 missense possibly damaging 0.79
R7385:Ttc8 UTSW 12 98942288 missense possibly damaging 0.78
R7447:Ttc8 UTSW 12 98943872 missense probably damaging 0.97
R8517:Ttc8 UTSW 12 98943335 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATATCCTCAAGTCAAATCCATGCC -3'
(R):5'- AAGTCCAATGTCCAATTCTGGC -3'

Sequencing Primer
(F):5'- GTCAAATCCATGCCCGGAC -3'
(R):5'- GGCCTGTAAGACTCTAGAGCTAC -3'
Posted On2019-10-24