Mutagenetix > Incidental Mutation

Incidental Mutation 'R5110:Stim1'

393801

Institutional Source

Beutler Lab

Gene Symbol

Stim1

Ensembl Gene

ENSMUSG00000030987

Gene Name

stromal interaction molecule 1

Synonyms

SIM

MMRRC Submission

042698-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5110 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102267806-102437319 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 102268422 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 3 (V3A)

Ref Sequence

ENSEMBL: ENSMUSP00000147410 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]

AlphaFold

P70302

Predicted Effect

unknown
Transcript: ENSMUST00000033289
AA Change: V3A

SMART Domains

Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: V3A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	32	47	N/A	INTRINSIC
SAM	129	200	5.51e-6	SMART
SCOP:d1eq1a_	229	334	1e-2	SMART
PDB:4O9B\|D	237	340	3e-59	PDB
Pfam:SOAR	341	441	1.4e-46	PFAM
low complexity region	485	499	N/A	INTRINSIC
low complexity region	601	631	N/A	INTRINSIC
low complexity region	672	685	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000209255
AA Change: V3A

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210266

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211141

Predicted Effect

unknown
Transcript: ENSMUST00000211457
AA Change: V3A

Meta Mutation Damage Score

0.0856

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 91.1%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	C	A	9: 124,295,357		probably null	Het
2310016G11Rik	G	A	7: 44,677,862		noncoding transcript	Het
Abi2	G	A	1: 60,450,121	V98I	probably benign	Het
Adam21	T	C	12: 81,560,215	T258A	probably benign	Het
Adam33	A	T	2: 131,053,770	C542S	probably damaging	Het
Adamts15	A	G	9: 30,921,444	V265A	probably benign	Het
Ahnak	A	T	19: 9,014,759	D4469V	probably damaging	Het
Aicda	A	G	6: 122,561,185	N101D	probably benign	Het
Als2	A	T	1: 59,185,441	D1040E	probably damaging	Het
Car15	T	C	16: 17,835,347	R319G	possibly damaging	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Col1a1	T	C	11: 94,941,593		probably null	Het
Col25a1	A	G	3: 130,584,725	*594W	probably null	Het
Cwf19l2	A	G	9: 3,450,012		probably null	Het
Dctn4	C	T	18: 60,546,315	P236S	probably damaging	Het
Ehmt1	C	A	2: 24,852,790	C459F	probably benign	Het
Enox1	T	C	14: 77,707,687		probably null	Het
Fam136b-ps	A	G	15: 31,276,710		probably benign	Het
Fzd1	T	C	5: 4,756,448	D378G	probably benign	Het
Golga5	G	A	12: 102,472,077	R17Q	probably benign	Het
Hk1	A	T	10: 62,286,651	Y422N	probably damaging	Het
Hsf4	A	G	8: 105,272,795	D255G	probably benign	Het
Ift81	A	G	5: 122,551,058	V665A	probably benign	Het
Igkv13-84	T	C	6: 68,939,608	F3L	probably benign	Het
Kcnh1	T	A	1: 192,337,747	S433R	possibly damaging	Het
Ktn1	A	G	14: 47,704,287		probably benign	Het
Lrp4	A	T	2: 91,497,072	D1471V	possibly damaging	Het
Macf1	A	T	4: 123,368,008	D6990E	probably damaging	Het
Map3k6	G	A	4: 133,247,548		probably benign	Het
Miox	T	A	15: 89,335,556	D82E	probably benign	Het
Olfr722	T	G	14: 49,895,575	I76L	possibly damaging	Het
Ovgp1	G	C	3: 105,977,783	R133P	probably damaging	Het
Per2	G	A	1: 91,429,515	T642I	possibly damaging	Het
Pparg	T	C	6: 115,473,003	V321A	probably damaging	Het
Pptc7	T	A	5: 122,308,249	N17K	probably benign	Het
Prpf19	T	C	19: 10,899,287		probably benign	Het
Rai14	T	C	15: 10,690,410		probably benign	Het
Sardh	T	C	2: 27,189,547	D911G	probably benign	Het
Sbf2	T	A	7: 110,364,657	T994S	probably benign	Het
Slc1a1	G	A	19: 28,911,808	E494K	probably benign	Het
Smarcc1	A	G	9: 110,197,784	K771E	possibly damaging	Het
St5	A	G	7: 109,542,490	S556P	probably benign	Het
Syne3	G	A	12: 104,943,370	R736C	probably benign	Het
Synj2	T	C	17: 6,037,715	V986A	probably benign	Het
Tinag	A	G	9: 76,952,007	S440P	probably damaging	Het
Tshz2	A	G	2: 169,884,197	T238A	possibly damaging	Het
Ttc8	T	C	12: 98,942,303	M17T	probably benign	Het
Tubgcp5	G	A	7: 55,808,637	R432Q	probably damaging	Het
Ugt1a10	T	A	1: 88,056,252		probably null	Het
Usp4	T	A	9: 108,362,678	I202N	probably damaging	Het
Vmn1r194	T	G	13: 22,245,000	S262R	probably benign	Het
Vmn2r101	T	C	17: 19,611,635	F631S	possibly damaging	Het
Vps13b	T	A	15: 35,770,809	S2133T	probably damaging	Het
Zfp13	C	A	17: 23,580,860	V77F	probably benign	Het
Zscan10	T	A	17: 23,609,632	C306S	probably damaging	Het

Other mutations in Stim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Stim1	APN	7	102426747	missense	probably damaging	1.00
IGL01390:Stim1	APN	7	102427162	missense	possibly damaging	0.73
IGL01602:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01605:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01697:Stim1	APN	7	102425969	splice site	probably benign
IGL01826:Stim1	APN	7	102427075	splice site	probably benign
IGL01908:Stim1	APN	7	102435650	missense	probably benign
IGL02869:Stim1	APN	7	102268551	missense	unknown
IGL03146:Stim1	APN	7	102421355	missense	probably damaging	1.00
R0217:Stim1	UTSW	7	102435800	missense	probably benign	0.00
R1320:Stim1	UTSW	7	102408406	missense	possibly damaging	0.79
R1639:Stim1	UTSW	7	102354541	missense	probably benign	0.31
R1643:Stim1	UTSW	7	102386100	missense	possibly damaging	0.92
R1697:Stim1	UTSW	7	102354506	missense	probably damaging	1.00
R2424:Stim1	UTSW	7	102408405	missense	probably benign	0.03
R3838:Stim1	UTSW	7	102411296	missense	possibly damaging	0.71
R3940:Stim1	UTSW	7	102435641	missense	probably benign	0.00
R4820:Stim1	UTSW	7	102415364	missense	probably damaging	0.97
R4871:Stim1	UTSW	7	102354572	missense	probably damaging	1.00
R5787:Stim1	UTSW	7	102435440	missense	possibly damaging	0.52
R6400:Stim1	UTSW	7	102430950	missense	probably null	0.99
R6788:Stim1	UTSW	7	102427291	missense	probably damaging	0.99
R7112:Stim1	UTSW	7	102408408	missense	probably benign	0.01
R7125:Stim1	UTSW	7	102435534	missense	possibly damaging	0.69
R7247:Stim1	UTSW	7	102421532	critical splice donor site	probably null
R7650:Stim1	UTSW	7	102428827	missense
R7807:Stim1	UTSW	7	102427141	missense	probably damaging	0.99
R8304:Stim1	UTSW	7	102435481	missense	possibly damaging	0.55
R8462:Stim1	UTSW	7	102427117	missense	probably damaging	1.00
R8528:Stim1	UTSW	7	102431082	intron	probably benign
R8883:Stim1	UTSW	7	102431050	missense	unknown
R8921:Stim1	UTSW	7	102421390	missense	probably damaging	0.99
R8924:Stim1	UTSW	7	102428807	missense
R9018:Stim1	UTSW	7	102411275	missense	probably benign	0.05
R9164:Stim1	UTSW	7	102435419	missense	probably benign	0.35
R9396:Stim1	UTSW	7	102415385	missense	possibly damaging	0.63
R9487:Stim1	UTSW	7	102431050	missense	unknown
R9501:Stim1	UTSW	7	102411299	missense	possibly damaging	0.92
R9697:Stim1	UTSW	7	102428807	missense
R9710:Stim1	UTSW	7	102430911	small deletion	probably benign
R9734:Stim1	UTSW	7	102415353	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- AACTTGGGGCACTTGACCTTC -3'
(R):5'- AGATTCCAACGTGCCCACTTC -3'

Sequencing Primer
(F):5'- CTTCGCTTATCGGAGGAGGTAAGC -3'
(R):5'- TCGGGCCACTCAGTCTTG -3'

Posted On

2016-06-15