Incidental Mutation 'R5113:Kdm4d'
ID394021
Institutional Source Beutler Lab
Gene Symbol Kdm4d
Ensembl Gene ENSMUSG00000053914
Gene Namelysine (K)-specific demethylase 4D
SynonymsJmjd2d
MMRRC Submission 042701-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5113 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location14462548-14500482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14464113 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 150 (N150D)
Ref Sequence ENSEMBL: ENSMUSP00000061632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058796] [ENSMUST00000115647]
Predicted Effect probably damaging
Transcript: ENSMUST00000058796
AA Change: N150D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061632
Gene: ENSMUSG00000053914
AA Change: N150D

DomainStartEndE-ValueType
Pfam:JmjN 16 50 3.3e-15 PFAM
JmjC 143 309 2.3e-57 SMART
low complexity region 370 383 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115647
AA Change: N150D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111311
Gene: ENSMUSG00000053914
AA Change: N150D

DomainStartEndE-ValueType
Pfam:JmjN 16 50 1.1e-16 PFAM
JmjC 143 309 2.3e-57 SMART
low complexity region 370 383 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of histone 3 methylation in spermatids, a transient increase in testes size, wider tubules, occasional male germ cell apoptosis, and decreased body weight. However, fertility is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,315,995 V622A possibly damaging Het
Ankef1 A G 2: 136,552,441 N590S probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano3 A T 2: 110,661,480 N867K possibly damaging Het
Ash1l T C 3: 89,066,275 V2547A probably damaging Het
Ccpg1os T A 9: 72,979,893 R111* probably null Het
Chil5 A T 3: 106,017,978 V209E possibly damaging Het
Cltc A T 11: 86,722,321 C459S probably damaging Het
Col6a4 T A 9: 106,066,960 D1105V possibly damaging Het
Cyp2c66 A G 19: 39,163,438 D199G probably benign Het
Cyp4f18 A G 8: 71,989,058 probably null Het
Cysrt1 A T 2: 25,239,351 C50S possibly damaging Het
Dapk1 A G 13: 60,721,778 K278R probably benign Het
Eefsec C A 6: 88,281,575 S512I probably damaging Het
Emilin1 T C 5: 30,920,620 F908L possibly damaging Het
Eml1 T C 12: 108,537,337 V731A possibly damaging Het
Erc2 T C 14: 27,652,872 S16P probably benign Het
Gfpt2 A G 11: 49,823,799 R342G probably damaging Het
Gpr142 A T 11: 114,804,317 Q36L probably benign Het
Grik5 A G 7: 25,015,527 S681P probably damaging Het
Hecw1 A T 13: 14,346,029 S208T possibly damaging Het
Hmgcr G A 13: 96,656,732 A464V probably benign Het
Igkv2-109 A G 6: 68,303,085 T97A possibly damaging Het
Ino80 G T 2: 119,431,945 Q687K probably damaging Het
Klf4 A G 4: 55,530,481 I210T possibly damaging Het
Klkb1 C A 8: 45,270,697 Q560H probably benign Het
Lce1a2 A T 3: 92,669,135 V40E unknown Het
Maob T C X: 16,716,423 T400A probably benign Het
Mipol1 C T 12: 57,496,499 T393I probably benign Het
Mst1 A G 9: 108,082,247 D244G probably damaging Het
Nexn G A 3: 152,243,888 R258C probably damaging Het
Olfr1353 A G 10: 78,970,203 I185V probably benign Het
Olfr748 A C 14: 50,710,914 I195L probably benign Het
Olfr777 A G 10: 129,268,666 I219T probably damaging Het
Olfr975 T C 9: 39,949,925 N282S probably damaging Het
Optc T C 1: 133,900,977 probably benign Het
Pabpc2 C A 18: 39,775,383 P567Q probably benign Het
Ppm1j A G 3: 104,784,674 H324R possibly damaging Het
Reg3g A T 6: 78,466,561 probably null Het
Sipa1l1 C T 12: 82,440,908 A1652V probably benign Het
Ski T C 4: 155,159,392 T554A probably benign Het
Slfn5 G A 11: 82,961,696 V883M probably benign Het
Stradb T C 1: 58,991,174 probably benign Het
Tex19.1 A G 11: 121,147,799 T328A probably benign Het
Tpsab1 T C 17: 25,345,399 N27S possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn A T 2: 76,812,900 L13225Q probably damaging Het
Vmn1r28 A G 6: 58,265,858 T229A probably benign Het
Wapl A G 14: 34,724,754 K600E probably damaging Het
Zfp217 T C 2: 170,114,058 probably null Het
Other mutations in Kdm4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Kdm4d APN 9 14464219 missense probably benign 0.10
IGL01114:Kdm4d APN 9 14464197 missense probably damaging 1.00
IGL01609:Kdm4d APN 9 14464418 missense probably damaging 0.99
IGL02342:Kdm4d APN 9 14463564 missense probably damaging 0.99
IGL02513:Kdm4d APN 9 14464554 missense probably benign 0.00
IGL03276:Kdm4d APN 9 14464542 missense probably benign 0.04
IGL03379:Kdm4d APN 9 14463843 missense probably damaging 1.00
R0220:Kdm4d UTSW 9 14463122 missense probably benign
R0755:Kdm4d UTSW 9 14464295 missense probably damaging 0.99
R1195:Kdm4d UTSW 9 14463099 missense probably benign
R1195:Kdm4d UTSW 9 14463099 missense probably benign
R1195:Kdm4d UTSW 9 14463099 missense probably benign
R1455:Kdm4d UTSW 9 14464395 missense probably damaging 0.98
R1552:Kdm4d UTSW 9 14464029 missense probably damaging 1.00
R1692:Kdm4d UTSW 9 14464511 missense probably benign 0.43
R1871:Kdm4d UTSW 9 14464383 missense probably damaging 1.00
R1892:Kdm4d UTSW 9 14464317 missense probably benign 0.14
R4792:Kdm4d UTSW 9 14463390 missense probably benign
R5211:Kdm4d UTSW 9 14463104 missense probably benign 0.04
R5352:Kdm4d UTSW 9 14464358 missense probably damaging 1.00
R6692:Kdm4d UTSW 9 14463065 missense probably benign
R7014:Kdm4d UTSW 9 14464179 missense probably damaging 0.99
R7198:Kdm4d UTSW 9 14464020 missense probably damaging 1.00
R7260:Kdm4d UTSW 9 14463158 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCACAGCATACCAGGTCTTG -3'
(R):5'- TCTTAATAGCAACTCCCCTGCAG -3'

Sequencing Primer
(F):5'- GGGCTGCCCAAAGTGTAG -3'
(R):5'- GCAGGCGTGTTCACCCAATAC -3'
Posted On2016-06-15