Incidental Mutation 'R5128:Chrna9'
ID394855
Institutional Source Beutler Lab
Gene Symbol Chrna9
Ensembl Gene ENSMUSG00000029205
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 9
Synonyms2410015I05Rik, Gm8311, Acra9
MMRRC Submission 042716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R5128 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location65934921-65977326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65971222 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 258 (S258G)
Ref Sequence ENSEMBL: ENSMUSP00000031108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031108] [ENSMUST00000201814] [ENSMUST00000202957]
Predicted Effect probably benign
Transcript: ENSMUST00000031108
AA Change: S258G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000031108
Gene: ENSMUSG00000029205
AA Change: S258G

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 31 237 2.7e-69 PFAM
Pfam:Neur_chan_memb 244 475 8.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153624
AA Change: S254G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118246
Gene: ENSMUSG00000029205
AA Change: S254G

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 27 233 1.3e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201664
Predicted Effect probably benign
Transcript: ENSMUST00000201814
AA Change: S254G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144364
Gene: ENSMUSG00000029205
AA Change: S254G

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 27 233 8.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202957
Meta Mutation Damage Score 0.1898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ligand-gated ionic channel family and nicotinic acetylcholine receptor gene superfamily. It encodes a plasma membrane protein that forms homo- or hetero-oligomeric divalent cation channels. This protein is involved in cochlea hair cell development and is also expressed in the outer hair cells (OHCs) of the adult cochlea. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in abnormal innervation of the outer hair cells and depressed olivocochlear response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,329 Q251* probably null Het
Abcc6 A G 7: 45,989,646 S958P probably benign Het
Ahnak T C 19: 9,017,087 L5245P probably damaging Het
Alg5 T A 3: 54,742,137 probably null Het
Anapc1 A G 2: 128,659,917 V735A probably benign Het
Arhgap45 A G 10: 80,030,959 T1099A probably benign Het
Cacna1e A C 1: 154,402,021 S2062A probably damaging Het
Ctcfl T C 2: 173,117,396 E179G probably benign Het
Dcdc2a C A 13: 25,102,529 A145E probably damaging Het
Dgkz A G 2: 91,942,683 I343T probably damaging Het
Dnah1 T C 14: 31,296,195 probably null Het
Dqx1 T C 6: 83,060,567 L374P probably damaging Het
Entpd5 A T 12: 84,394,690 F101L probably benign Het
Esco1 A T 18: 10,567,468 probably benign Het
Fgf1 C A 18: 38,842,025 V124L probably benign Het
Gm16380 C T 9: 53,884,113 noncoding transcript Het
Grid2 G A 6: 64,665,998 A915T probably benign Het
Inhbc A T 10: 127,357,742 M135K probably benign Het
Mertk C A 2: 128,738,247 T207K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mtmr10 C T 7: 64,333,439 T498I probably damaging Het
Muc3 A G 5: 137,138,186 probably null Het
Nlrp1c-ps G T 11: 71,279,595 noncoding transcript Het
Nphp4 T A 4: 152,502,991 I267N probably benign Het
Obox8 A G 7: 14,332,090 W168R probably damaging Het
Olfr1247 A T 2: 89,609,303 D266E probably damaging Het
Olfr143 T C 9: 38,253,570 L48P probably damaging Het
Olfr330 A T 11: 58,529,422 V188E probably damaging Het
Pafah1b1 A G 11: 74,679,436 probably benign Het
Palld T C 8: 61,720,588 T346A probably damaging Het
Pip4k2b A G 11: 97,718,876 S412P probably benign Het
Scn3a T C 2: 65,508,518 S606G probably benign Het
Slc12a7 G T 13: 73,805,433 S754I probably benign Het
Tep1 A G 14: 50,844,279 *489R probably null Het
Tnn A T 1: 160,122,894 V714E probably damaging Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Ttc16 T A 2: 32,762,997 I550F probably benign Het
Vit T C 17: 78,625,146 S561P probably damaging Het
Zdhhc1 T A 8: 105,483,636 I50F probably benign Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp597 G A 16: 3,872,124 probably benign Het
Other mutations in Chrna9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Chrna9 APN 5 65969257 missense probably benign 0.25
IGL00742:Chrna9 APN 5 65971115 missense probably benign 0.12
IGL01611:Chrna9 APN 5 65970944 missense probably damaging 1.00
IGL02376:Chrna9 APN 5 65971159 missense probably damaging 1.00
R0403:Chrna9 UTSW 5 65967892 missense possibly damaging 0.89
R1506:Chrna9 UTSW 5 65969136 missense probably benign 0.19
R2943:Chrna9 UTSW 5 65977095 missense probably damaging 1.00
R4243:Chrna9 UTSW 5 65935036 critical splice donor site probably null
R4290:Chrna9 UTSW 5 65977138 missense probably benign 0.11
R4607:Chrna9 UTSW 5 65976735 missense possibly damaging 0.77
R4737:Chrna9 UTSW 5 65967871 missense probably damaging 1.00
R4814:Chrna9 UTSW 5 65977149 missense probably damaging 1.00
R4932:Chrna9 UTSW 5 65969190 nonsense probably null
R5044:Chrna9 UTSW 5 65971016 missense probably damaging 0.99
R5213:Chrna9 UTSW 5 65971084 nonsense probably null
R5242:Chrna9 UTSW 5 65977080 missense probably benign
R6760:Chrna9 UTSW 5 65971228 missense probably damaging 1.00
R7131:Chrna9 UTSW 5 65977141 missense possibly damaging 0.92
Z1177:Chrna9 UTSW 5 65971220 missense not run
Predicted Primers PCR Primer
(F):5'- TTCAATGCCCTGGACAGTGG -3'
(R):5'- TTGGGACATACACACGCCATC -3'

Sequencing Primer
(F):5'- CTCTGACTTCATTGAAGACGTG -3'
(R):5'- GCCATCACAACTGCTACAAAG -3'
Posted On2016-06-21