Incidental Mutation 'R5128:Gm16380'
ID394865
Institutional Source Beutler Lab
Gene Symbol Gm16380
Ensembl Gene ENSMUSG00000059830
Gene Namepredicted pseudogene 16380
Synonyms
MMRRC Submission 042716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R5128 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location53884082-53884561 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) C to T at 53884113 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000077997
SMART Domains Protein: ENSMUSP00000129245
Gene: ENSMUSG00000059830

DomainStartEndE-ValueType
Pfam:Siva 1 152 6.6e-65 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,329 Q251* probably null Het
Abcc6 A G 7: 45,989,646 S958P probably benign Het
Ahnak T C 19: 9,017,087 L5245P probably damaging Het
Alg5 T A 3: 54,742,137 probably null Het
Anapc1 A G 2: 128,659,917 V735A probably benign Het
Arhgap45 A G 10: 80,030,959 T1099A probably benign Het
Cacna1e A C 1: 154,402,021 S2062A probably damaging Het
Chrna9 A G 5: 65,971,222 S258G probably benign Het
Ctcfl T C 2: 173,117,396 E179G probably benign Het
Dcdc2a C A 13: 25,102,529 A145E probably damaging Het
Dgkz A G 2: 91,942,683 I343T probably damaging Het
Dnah1 T C 14: 31,296,195 probably null Het
Dqx1 T C 6: 83,060,567 L374P probably damaging Het
Entpd5 A T 12: 84,394,690 F101L probably benign Het
Esco1 A T 18: 10,567,468 probably benign Het
Fgf1 C A 18: 38,842,025 V124L probably benign Het
Grid2 G A 6: 64,665,998 A915T probably benign Het
Inhbc A T 10: 127,357,742 M135K probably benign Het
Mertk C A 2: 128,738,247 T207K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mtmr10 C T 7: 64,333,439 T498I probably damaging Het
Muc3 A G 5: 137,138,186 probably null Het
Nlrp1c-ps G T 11: 71,279,595 noncoding transcript Het
Nphp4 T A 4: 152,502,991 I267N probably benign Het
Obox8 A G 7: 14,332,090 W168R probably damaging Het
Olfr1247 A T 2: 89,609,303 D266E probably damaging Het
Olfr143 T C 9: 38,253,570 L48P probably damaging Het
Olfr330 A T 11: 58,529,422 V188E probably damaging Het
Pafah1b1 A G 11: 74,679,436 probably benign Het
Palld T C 8: 61,720,588 T346A probably damaging Het
Pip4k2b A G 11: 97,718,876 S412P probably benign Het
Scn3a T C 2: 65,508,518 S606G probably benign Het
Slc12a7 G T 13: 73,805,433 S754I probably benign Het
Tep1 A G 14: 50,844,279 *489R probably null Het
Tnn A T 1: 160,122,894 V714E probably damaging Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Ttc16 T A 2: 32,762,997 I550F probably benign Het
Vit T C 17: 78,625,146 S561P probably damaging Het
Zdhhc1 T A 8: 105,483,636 I50F probably benign Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp597 G A 16: 3,872,124 probably benign Het
Other mutations in Gm16380
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02207:Gm16380 APN 9 53884539 exon noncoding transcript
R0386:Gm16380 UTSW 9 53884443 exon noncoding transcript
R0398:Gm16380 UTSW 9 53884169 exon noncoding transcript
R0512:Gm16380 UTSW 9 53884245 exon noncoding transcript
R1419:Gm16380 UTSW 9 53884187 exon noncoding transcript
R2301:Gm16380 UTSW 9 53884200 exon noncoding transcript
R3697:Gm16380 UTSW 9 53884452 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTTTCACAGACTCTGGCCTTTAATGG -3'
(R):5'- CAGACTTCAGTGACTCCCGTAG -3'

Sequencing Primer
(F):5'- AGACTCTGGCCTTTAATGGGTCTTC -3'
(R):5'- GGTGGTTCACAGAACAATCTTCGC -3'
Posted On2016-06-21