Incidental Mutation 'R5044:Chrna9'
ID 394247
Institutional Source Beutler Lab
Gene Symbol Chrna9
Ensembl Gene ENSMUSG00000029205
Gene Name cholinergic receptor, nicotinic, alpha polypeptide 9
Synonyms 2410015I05Rik, Gm8311, Acra9
MMRRC Submission 042634-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock # R5044 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 65934921-65977326 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65971016 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 189 (L189P)
Ref Sequence ENSEMBL: ENSMUSP00000031108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031108] [ENSMUST00000201814] [ENSMUST00000202957]
AlphaFold G3X8Z7
Predicted Effect probably damaging
Transcript: ENSMUST00000031108
AA Change: L189P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031108
Gene: ENSMUSG00000029205
AA Change: L189P

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 31 237 2.7e-69 PFAM
Pfam:Neur_chan_memb 244 475 8.6e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000153624
AA Change: L185P

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118246
Gene: ENSMUSG00000029205
AA Change: L185P

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 27 233 1.3e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201664
Predicted Effect possibly damaging
Transcript: ENSMUST00000201814
AA Change: L185P

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144364
Gene: ENSMUSG00000029205
AA Change: L185P

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 27 233 8.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202957
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ligand-gated ionic channel family and nicotinic acetylcholine receptor gene superfamily. It encodes a plasma membrane protein that forms homo- or hetero-oligomeric divalent cation channels. This protein is involved in cochlea hair cell development and is also expressed in the outer hair cells (OHCs) of the adult cochlea. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in abnormal innervation of the outer hair cells and depressed olivocochlear response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,323 F3387I possibly damaging Het
Acacb T A 5: 114,166,027 S170R probably benign Het
Adamtsl4 A G 3: 95,681,650 probably null Het
Adgrv1 A G 13: 81,488,931 C3464R probably benign Het
Apbb1 A T 7: 105,565,682 probably benign Het
Cad A G 5: 31,055,021 T23A probably benign Het
Cdca7 A G 2: 72,483,415 R183G probably benign Het
Cdpf1 T C 15: 85,809,312 T5A probably benign Het
Cep85 T C 4: 134,156,179 D133G probably damaging Het
Clca1 A C 3: 145,007,928 probably null Het
Cntn1 G T 15: 92,242,995 V201F probably damaging Het
Col4a3 A G 1: 82,666,546 E352G unknown Het
Ddhd2 T C 8: 25,752,137 Y237C probably damaging Het
Dnah6 A C 6: 73,037,622 F3609V probably benign Het
Epha3 T C 16: 63,602,287 K580R possibly damaging Het
Fam135b T C 15: 71,462,711 N878S probably benign Het
Fam71e2 T C 7: 4,758,661 N351D probably benign Het
Fbn1 T G 2: 125,329,102 T1938P probably damaging Het
Foxg1 T C 12: 49,385,186 V234A probably damaging Het
Glt1d1 A T 5: 127,644,414 N55I probably benign Het
Gm17641 C A 3: 68,869,474 probably benign Het
Gm7665 A G 18: 16,274,731 noncoding transcript Het
Hgf A C 5: 16,614,894 N541T probably benign Het
Hipk2 G A 6: 38,818,879 P152S probably benign Het
Jarid2 C T 13: 44,906,565 L720F probably damaging Het
Kifc5b A G 17: 26,924,787 E511G probably damaging Het
Ldlr G A 9: 21,735,242 A235T probably benign Het
Lmln A G 16: 33,074,180 D231G possibly damaging Het
Lrp1 A G 10: 127,567,495 C2070R probably damaging Het
Mbl1 A G 14: 41,158,724 T190A possibly damaging Het
Mpdz A T 4: 81,381,697 S355T probably benign Het
Muc19 C T 15: 91,888,138 noncoding transcript Het
Mycbp2 A C 14: 103,139,235 probably null Het
Naa20 T C 2: 145,915,842 S164P probably damaging Het
Nme4 A T 17: 26,093,833 probably benign Het
Npas2 A T 1: 39,347,506 R619* probably null Het
Nudt19 G A 7: 35,555,746 T20I possibly damaging Het
Olfr1224-ps1 T A 2: 89,156,939 K79* probably null Het
Olfr1447 A G 19: 12,901,001 Y260H probably damaging Het
Pitpnc1 A G 11: 107,296,228 Y90H possibly damaging Het
Rcor2 A G 19: 7,269,785 T6A probably benign Het
Rif1 T A 2: 52,109,928 S1131R probably damaging Het
Rtkn T A 6: 83,150,991 D377E probably benign Het
Rtn4rl2 T A 2: 84,872,502 N242I probably damaging Het
Sbno2 G A 10: 80,062,188 L719F probably benign Het
Scn11a G T 9: 119,819,831 D55E probably damaging Het
Setd1b T A 5: 123,151,866 I632N unknown Het
Spaca6 A G 17: 17,831,196 T45A probably benign Het
Srpk2 A T 5: 23,524,392 D416E possibly damaging Het
Sspo A T 6: 48,466,955 probably null Het
Sycp1 A T 3: 102,845,054 I804N probably benign Het
Tdp2 G A 13: 24,831,826 R32Q probably benign Het
Tgfbr3 A G 5: 107,136,929 V618A possibly damaging Het
Tmc3 C T 7: 83,609,118 P439S probably benign Het
Tnxb A T 17: 34,717,483 D2740V probably damaging Het
Tspyl4 A G 10: 34,297,937 T142A probably benign Het
Ttn T C 2: 76,880,441 probably benign Het
Tubgcp4 T C 2: 121,173,580 L34P probably damaging Het
Tubgcp6 G T 15: 89,099,545 probably benign Het
Unc79 T A 12: 103,112,703 V1690E probably benign Het
Vps4b T C 1: 106,796,418 probably null Het
Wtap A G 17: 12,967,638 S341P possibly damaging Het
Wwc1 T C 11: 35,883,345 T363A probably benign Het
Zbtb8a G A 4: 129,360,500 T67M probably damaging Het
Zfp865 T C 7: 5,034,669 probably benign Het
Other mutations in Chrna9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Chrna9 APN 5 65969257 missense probably benign 0.25
IGL00742:Chrna9 APN 5 65971115 missense probably benign 0.12
IGL01611:Chrna9 APN 5 65970944 missense probably damaging 1.00
IGL02376:Chrna9 APN 5 65971159 missense probably damaging 1.00
R0403:Chrna9 UTSW 5 65967892 missense possibly damaging 0.89
R1506:Chrna9 UTSW 5 65969136 missense probably benign 0.19
R2943:Chrna9 UTSW 5 65977095 missense probably damaging 1.00
R4243:Chrna9 UTSW 5 65935036 critical splice donor site probably null
R4290:Chrna9 UTSW 5 65977138 missense probably benign 0.11
R4607:Chrna9 UTSW 5 65976735 missense possibly damaging 0.77
R4737:Chrna9 UTSW 5 65967871 missense probably damaging 1.00
R4814:Chrna9 UTSW 5 65977149 missense probably damaging 1.00
R4932:Chrna9 UTSW 5 65969190 nonsense probably null
R5128:Chrna9 UTSW 5 65971222 missense probably benign 0.00
R5213:Chrna9 UTSW 5 65971084 nonsense probably null
R5242:Chrna9 UTSW 5 65977080 missense probably benign
R6760:Chrna9 UTSW 5 65971228 missense probably damaging 1.00
R7131:Chrna9 UTSW 5 65977141 missense possibly damaging 0.92
R9328:Chrna9 UTSW 5 65971226 missense probably damaging 1.00
Z1177:Chrna9 UTSW 5 65971220 missense probably damaging 1.00
Z1187:Chrna9 UTSW 5 65976780 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTTCAGAGCCGGTGAACAC -3'
(R):5'- CTGCTGGGAGGTAGAAACTC -3'

Sequencing Primer
(F):5'- CCAACGTGGTCCTGCGG -3'
(R):5'- CTGGGAGGTAGAAACTCAGCGG -3'
Posted On 2016-06-15