Incidental Mutation 'R5095:Picalm'
ID395821
Institutional Source Beutler Lab
Gene Symbol Picalm
Ensembl Gene ENSMUSG00000039361
Gene Namephosphatidylinositol binding clathrin assembly protein
Synonymsfit-1, fit1
MMRRC Submission 042684-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock #R5095 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location90130213-90213465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90170633 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 85 (F85L)
Ref Sequence ENSEMBL: ENSMUSP00000146509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049537] [ENSMUST00000207084] [ENSMUST00000207225] [ENSMUST00000207484] [ENSMUST00000208730] [ENSMUST00000208742] [ENSMUST00000209068]
Predicted Effect probably damaging
Transcript: ENSMUST00000049537
AA Change: F201L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051092
Gene: ENSMUSG00000039361
AA Change: F201L

DomainStartEndE-ValueType
ENTH 20 145 2.42e-39 SMART
coiled coil region 317 349 N/A INTRINSIC
low complexity region 378 387 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207084
AA Change: F85L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000207225
AA Change: F201L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000207484
AA Change: F201L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207949
Predicted Effect probably benign
Transcript: ENSMUST00000208089
Predicted Effect probably damaging
Transcript: ENSMUST00000208730
AA Change: F201L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000208742
AA Change: F201L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000209068
AA Change: F201L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.8333 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a clathrin assembly protein, which recruits clathrin and adaptor protein complex 2 (AP2) to cell membranes at sites of coated-pit formation and clathrin-vesicle assembly. The protein may be required to determine the amount of membrane to be recycled, possibly by regulating the size of the clathrin cage. The protein is involved in AP2-dependent clathrin-mediated endocytosis at the neuromuscular junction. A chromosomal translocation t(10;11)(p13;q14) leading to the fusion of this gene and the MLLT10 gene is found in acute lymphoblastic leukemia, acute myeloid leukemia and malignant lymphomas. The polymorphisms of this gene are associated with the risk of Alzheimer disease. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for different ENU-induced mutations or knock-out alleles are small, runted and display anemia of variable severity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021A07Rik G C 10: 21,425,593 noncoding transcript Het
4932415D10Rik G T 10: 82,283,667 A4503E probably damaging Het
Adgrv1 C T 13: 81,095,487 V6265I probably benign Het
Agbl1 G A 7: 76,720,133 G660D probably damaging Het
Arap2 A G 5: 62,654,049 Y1140H probably damaging Het
Atp6v1c1 T C 15: 38,679,413 probably null Het
C1rb A T 6: 124,580,313 R470W possibly damaging Het
Caskin2 T C 11: 115,800,738 T1074A probably benign Het
Cdh19 T A 1: 110,954,661 T34S probably benign Het
Csnk1a1 T A 18: 61,575,476 Y175N probably damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Flt4 T A 11: 49,627,159 V342D possibly damaging Het
Frmd5 A T 2: 121,548,921 C394S possibly damaging Het
Gm5414 T G 15: 101,624,038 N550T probably benign Het
Hcn3 C A 3: 89,149,923 R456L probably damaging Het
Htt T C 5: 34,824,395 V893A possibly damaging Het
Ift46 A G 9: 44,786,849 D203G probably damaging Het
Itga10 G T 3: 96,648,164 V145L probably benign Het
Kcnh6 A G 11: 106,017,254 D232G possibly damaging Het
Mbtd1 T C 11: 93,929,671 S431P probably damaging Het
Mmp27 T A 9: 7,572,158 W120R probably damaging Het
Mmp27 A T 9: 7,579,000 D418V probably damaging Het
Myo5a A G 9: 75,152,020 D510G probably damaging Het
Myo5a A T 9: 75,184,389 K1179* probably null Het
Neto1 T C 18: 86,398,281 S38P probably benign Het
Nos3 A G 5: 24,368,918 probably benign Het
Nuggc C T 14: 65,635,090 R512* probably null Het
Oas1e T A 5: 120,794,264 K105* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr512 T C 7: 108,713,812 F141S probably damaging Het
Omd T A 13: 49,589,698 S75T possibly damaging Het
Pbrm1 A G 14: 31,032,530 N190S probably benign Het
Polg A G 7: 79,460,300 V360A possibly damaging Het
Prex1 T C 2: 166,581,921 D1017G probably damaging Het
Prss56 G C 1: 87,188,111 R569P probably damaging Het
Rab6b G A 9: 103,140,384 G25R probably damaging Het
Rdh10 A G 1: 16,131,385 T332A probably benign Het
Rheb A T 5: 24,807,641 M115K probably benign Het
Rnf149 A T 1: 39,555,656 D321E probably benign Het
Rps28 C T 17: 33,823,203 probably null Het
Slc6a20b A G 9: 123,595,054 V616A probably benign Het
Smarcc2 A G 10: 128,469,300 K300R probably damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Srp68 C T 11: 116,248,747 V459M probably damaging Het
Stxbp4 C T 11: 90,548,975 V346I probably benign Het
Syne2 A G 12: 75,952,826 D2331G probably damaging Het
Ttn A T 2: 76,734,192 Y28534N probably damaging Het
Usp44 A T 10: 93,846,845 I386F possibly damaging Het
Vmn2r15 T C 5: 109,288,451 probably null Het
Vmn2r72 T A 7: 85,737,853 L834F probably damaging Het
Vps13b T A 15: 35,923,202 I3741K probably damaging Het
Zdbf2 A G 1: 63,309,073 T2204A possibly damaging Het
Zfp607b T A 7: 27,693,636 probably benign Het
Other mutations in Picalm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Picalm APN 7 90161318 missense probably damaging 1.00
IGL01147:Picalm APN 7 90177592 missense probably benign 0.42
IGL02814:Picalm APN 7 90191749 missense possibly damaging 0.75
IGL02828:Picalm APN 7 90177501 missense probably benign
IGL02904:Picalm APN 7 90176411 splice site probably benign
IGL02986:Picalm APN 7 90207585 missense probably benign 0.00
IGL03001:Picalm APN 7 90182246 missense probably benign 0.00
IGL03247:Picalm APN 7 90194291 missense probably benign 0.27
R0024:Picalm UTSW 7 90130704 critical splice donor site probably null
R0085:Picalm UTSW 7 90182317 missense probably benign
R0414:Picalm UTSW 7 90189198 missense possibly damaging 0.94
R0537:Picalm UTSW 7 90130668 missense probably benign 0.05
R0855:Picalm UTSW 7 90191148 missense possibly damaging 0.55
R1269:Picalm UTSW 7 90165549 nonsense probably null
R1496:Picalm UTSW 7 90130651 missense probably benign 0.36
R1635:Picalm UTSW 7 90191251 missense probably damaging 1.00
R1750:Picalm UTSW 7 90191182 missense possibly damaging 0.81
R1755:Picalm UTSW 7 90160549 missense possibly damaging 0.88
R2513:Picalm UTSW 7 90197009 missense probably damaging 1.00
R3850:Picalm UTSW 7 90191704 missense probably damaging 1.00
R3874:Picalm UTSW 7 90189219 missense probably damaging 1.00
R5368:Picalm UTSW 7 90207595 makesense probably null
R5517:Picalm UTSW 7 90170598 missense possibly damaging 0.68
R6012:Picalm UTSW 7 90195700 missense probably benign
R6280:Picalm UTSW 7 90177562 missense probably benign 0.00
R6739:Picalm UTSW 7 90176708 missense probably damaging 1.00
R6951:Picalm UTSW 7 90191375 missense probably damaging 1.00
R7083:Picalm UTSW 7 90176768 missense probably benign 0.01
R7877:Picalm UTSW 7 90130668 missense probably benign 0.05
R7960:Picalm UTSW 7 90130668 missense probably benign 0.05
Z1176:Picalm UTSW 7 90196967 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCTCATAAGGGAAAGTAAGCCC -3'
(R):5'- AGGCTTTTCCCATCTAACTTTACAG -3'

Sequencing Primer
(F):5'- GGGAAAGTAAGCCCCCTTTTC -3'
(R):5'- AATGAGAATTTATTCACGTGTGGTTG -3'
Posted On2016-06-21