Incidental Mutation 'R5143:Usp17lb'
ID396524
Institutional Source Beutler Lab
Gene Symbol Usp17lb
Ensembl Gene ENSMUSG00000062369
Gene Nameubiquitin specific peptidase 17-like B
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R5143 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104840257-104842603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104841478 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 80 (S80T)
Ref Sequence ENSEMBL: ENSMUSP00000102427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076501] [ENSMUST00000106814]
Predicted Effect probably damaging
Transcript: ENSMUST00000076501
AA Change: S81T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075822
Gene: ENSMUSG00000062369
AA Change: S81T

DomainStartEndE-ValueType
Pfam:UCH 50 345 3.2e-55 PFAM
Pfam:UCH_1 51 327 6.8e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106814
AA Change: S80T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102427
Gene: ENSMUSG00000062369
AA Change: S80T

DomainStartEndE-ValueType
Pfam:UCH 49 344 2.3e-61 PFAM
Pfam:UCH_1 50 326 1.5e-30 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,739,198 probably null Het
Abcc2 T C 19: 43,821,661 I886T probably benign Het
Adrb2 T C 18: 62,178,776 Y326C probably damaging Het
AF366264 A G 8: 13,836,844 S416P possibly damaging Het
Aplp1 G A 7: 30,441,123 R334C probably damaging Het
AY358078 T C 14: 51,802,549 S39P unknown Het
Bpifb2 A T 2: 153,878,504 D61V probably damaging Het
Caap1 A T 4: 94,501,382 N238K probably damaging Het
Cfap54 A G 10: 93,029,158 V726A possibly damaging Het
Chrna7 T C 7: 63,106,147 Y217C probably damaging Het
Crocc T A 4: 141,041,039 T414S probably benign Het
Cyp2a12 A G 7: 27,036,611 I482V probably benign Het
Dnah6 A T 6: 73,181,761 F620I possibly damaging Het
Eogt A G 6: 97,125,584 L256P probably damaging Het
F5 A G 1: 164,211,828 I2002M probably damaging Het
Foxp1 A G 6: 98,945,532 probably null Het
Fut8 A G 12: 77,365,209 D111G probably benign Het
Gm17689 T A 9: 36,581,904 N41Y probably benign Het
Golgb1 C T 16: 36,898,689 A319V probably benign Het
Hoxd3 C T 2: 74,746,372 R39C probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Olfr690 T A 7: 105,329,524 I223F probably damaging Het
Pcdhb2 A G 18: 37,296,732 Y586C probably damaging Het
Plcd1 G A 9: 119,074,451 Q442* probably null Het
Plppr5 A G 3: 117,625,903 T207A probably benign Het
Pomt1 C A 2: 32,254,329 A709E probably benign Het
Prmt8 A G 6: 127,732,714 M61T probably benign Het
Ptpn23 A G 9: 110,385,438 probably benign Het
Sbf2 T A 7: 110,422,540 K493* probably null Het
Tmc2 A T 2: 130,234,818 S355C probably damaging Het
Tonsl A G 15: 76,636,657 S399P possibly damaging Het
Ttc14 T C 3: 33,808,901 probably benign Het
Ttn A G 2: 76,738,065 S19168P probably damaging Het
Vmn2r96 A G 17: 18,583,858 I457V possibly damaging Het
Wdr64 G T 1: 175,726,413 D170Y probably damaging Het
Zbtb42 T C 12: 112,679,514 V41A probably damaging Het
Other mutations in Usp17lb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Usp17lb APN 7 104841229 missense probably damaging 0.98
IGL01571:Usp17lb APN 7 104840381 missense possibly damaging 0.59
IGL01624:Usp17lb APN 7 104842513 utr 5 prime probably benign
IGL02582:Usp17lb APN 7 104840730 missense probably damaging 1.00
IGL03193:Usp17lb APN 7 104841277 missense possibly damaging 0.46
R0399:Usp17lb UTSW 7 104841151 missense possibly damaging 0.81
R0420:Usp17lb UTSW 7 104840539 missense probably benign
R1202:Usp17lb UTSW 7 104842488 missense probably damaging 0.98
R1628:Usp17lb UTSW 7 104840841 missense probably damaging 1.00
R2085:Usp17lb UTSW 7 104840415 missense possibly damaging 0.73
R2214:Usp17lb UTSW 7 104841432 missense probably benign 0.36
R2283:Usp17lb UTSW 7 104840652 missense possibly damaging 0.68
R2866:Usp17lb UTSW 7 104840748 missense probably damaging 1.00
R3433:Usp17lb UTSW 7 104841648 missense possibly damaging 0.89
R5004:Usp17lb UTSW 7 104841677 missense probably benign 0.00
R5090:Usp17lb UTSW 7 104841083 missense probably benign 0.06
R5366:Usp17lb UTSW 7 104840408 missense possibly damaging 0.95
R5568:Usp17lb UTSW 7 104841208 missense probably damaging 1.00
R5605:Usp17lb UTSW 7 104840640 missense probably benign 0.00
R5647:Usp17lb UTSW 7 104840674 missense possibly damaging 0.92
R5981:Usp17lb UTSW 7 104841187 missense probably damaging 1.00
R5999:Usp17lb UTSW 7 104840345 missense probably damaging 0.99
R6114:Usp17lb UTSW 7 104840364 missense possibly damaging 0.87
R6185:Usp17lb UTSW 7 104841424 missense probably benign 0.22
R6279:Usp17lb UTSW 7 104840691 missense probably damaging 1.00
R6300:Usp17lb UTSW 7 104840691 missense probably damaging 1.00
R6891:Usp17lb UTSW 7 104841100 missense probably benign 0.02
R7000:Usp17lb UTSW 7 104841285 missense probably damaging 1.00
R7137:Usp17lb UTSW 7 104841591 missense probably benign 0.15
R7318:Usp17lb UTSW 7 104841133 missense probably benign 0.03
R7372:Usp17lb UTSW 7 104841706 splice site probably null
R7809:Usp17lb UTSW 7 104841213 missense probably damaging 1.00
R7834:Usp17lb UTSW 7 104841511 missense probably damaging 1.00
R8008:Usp17lb UTSW 7 104841274 missense possibly damaging 0.82
R8283:Usp17lb UTSW 7 104840806 missense probably damaging 0.98
R8385:Usp17lb UTSW 7 104840623 missense possibly damaging 0.82
X0021:Usp17lb UTSW 7 104841316 missense probably damaging 1.00
Z1088:Usp17lb UTSW 7 104841129 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AACTCATGGGCATCTTCCTG -3'
(R):5'- TTGTGTTCTTGTCCCATAGCAG -3'

Sequencing Primer
(F):5'- GGGCATCTTCCTGCTTGCG -3'
(R):5'- TTGTCCCATAGCAGATCCAGC -3'
Posted On2016-06-21