Mutagenetix > Incidental Mutations

Incidental Mutation 'R5170:Zp1'

397530

Institutional Source

Beutler Lab

Gene Symbol

Zp1

Ensembl Gene

ENSMUSG00000024734

Gene Name

zona pellucida glycoprotein 1

Synonyms

MMRRC Submission

042750-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R5170 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10914287-10920632 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 10920554 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 8 (V8F)

Ref Sequence

ENSEMBL: ENSMUSP00000025641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025641] [ENSMUST00000168708]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025641
AA Change: V8F

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000025641
Gene: ENSMUSG00000024734
AA Change: V8F

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	184	199	N/A	INTRINSIC
PD	226	269	2.33e-11	SMART
ZP	271	542	1.55e-102	SMART
low complexity region	580	589	N/A	INTRINSIC
transmembrane domain	591	613	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168708

SMART Domains

Protein: ENSMUSP00000128543
Gene: ENSMUSG00000024734

Domain	Start	End	E-Value	Type
Pfam:Zona_pellucida	3	61	5.6e-8	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zona pellucida is an extracellular matrix that surrounds the oocyte and early embryo. It is composed primarily of three or four glycoproteins with various functions during fertilization and preimplantation development. The protein encoded by this gene ensures the structural integrity of the zona pellucida. Mutations in this gene are a cause of oocyte maturation defect and infertility. [provided by RefSeq, May 2014]
PHENOTYPE: Female homozygous mutants produce oocytes with abnormal zona pellucida. Fecunditiy is significantly reduced, probably due to precocious hatching. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox3	A	G	5: 35,588,625	I51V	probably benign	Het
Agbl2	A	G	2: 90,803,197	K559R	probably benign	Het
Arhgap30	A	G	1: 171,408,050	D664G	probably benign	Het
BC034090	A	G	1: 155,213,650	V798A	probably damaging	Het
Bdp1	A	T	13: 100,030,794	C2237*	probably null	Het
C3	C	T	17: 57,223,938	V388M	probably damaging	Het
Ccdc170	G	A	10: 4,514,200	E60K	probably damaging	Het
Cdh8	G	A	8: 99,279,550	T135M	probably damaging	Het
Cep131	G	T	11: 120,070,609	A572E	probably damaging	Het
Clec16a	A	G	16: 10,741,791	Y976C	probably benign	Het
Dmpk	C	G	7: 19,088,019	L301V	probably benign	Het
Eno3	A	G	11: 70,662,214	I393V	probably benign	Het
Fbxo47	A	G	11: 97,857,694	V305A	probably benign	Het
Fry	G	A	5: 150,429,854	V1779M	probably benign	Het
Gm15293	A	T	8: 21,201,680	D26V	probably damaging	Het
Gtse1	T	C	15: 85,864,264		probably null	Het
Gucy2e	A	T	11: 69,235,570	L328Q	probably damaging	Het
Ifi207	T	C	1: 173,730,498	T225A	unknown	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Lamc3	A	T	2: 31,887,344	M1L	probably benign	Het
Lman1l	G	A	9: 57,615,619	R153*	probably null	Het
Myo16	A	G	8: 10,569,745	D1432G	probably benign	Het
Nwd2	A	T	5: 63,806,037	N988I	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Parp14	T	C	16: 35,857,279	E773G	probably benign	Het
Psen1	T	A	12: 83,714,862	M146K	probably damaging	Het
Ptx4	G	A	17: 25,123,178	R209Q	probably benign	Het
Slc13a2	T	C	11: 78,400,808	T340A	probably damaging	Het
St8sia1	T	C	6: 142,963,708	K21E	probably damaging	Het
Stxbp1	T	C	2: 32,794,674	D581G	probably benign	Het
Sumo2	G	A	11: 115,534,660		probably benign	Het
Supt5	G	A	7: 28,316,083	P910S	probably benign	Het
Tbc1d30	T	C	10: 121,306,838	Q158R	possibly damaging	Het
Tenm2	T	A	11: 36,024,806	H1968L	probably damaging	Het
Trmt1	T	C	8: 84,695,232	Y220H	probably damaging	Het
Trp73	C	T	4: 154,104,838	E60K	possibly damaging	Het
Ttn	A	G	2: 76,787,069	Y8026H	probably damaging	Het
Zar1l	A	G	5: 150,517,585		probably null	Het
Zfp740	T	C	15: 102,209,205	Y117H	probably damaging	Het
Zfp941	G	A	7: 140,812,957		probably benign	Het

Other mutations in Zp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Zp1	APN	19	10918777	missense	probably damaging	1.00
IGL01504:Zp1	APN	19	10919011	missense	probably damaging	0.99
IGL02260:Zp1	APN	19	10916714	unclassified	probably benign
IGL02465:Zp1	APN	19	10920487	missense	probably benign	0.09
IGL02634:Zp1	APN	19	10919507	unclassified	probably benign
IGL02714:Zp1	APN	19	10918612	missense	probably damaging	1.00
IGL03234:Zp1	APN	19	10914823	splice site	probably benign
IGL03404:Zp1	APN	19	10914461	unclassified	probably benign
R0504:Zp1	UTSW	19	10916207	missense	probably damaging	0.98
R0554:Zp1	UTSW	19	10920562	missense	probably benign	0.29
R1028:Zp1	UTSW	19	10918911	missense	probably benign	0.01
R1279:Zp1	UTSW	19	10918577	missense	probably damaging	1.00
R1460:Zp1	UTSW	19	10918878	missense	probably benign
R3425:Zp1	UTSW	19	10918592	missense	probably benign	0.00
R3832:Zp1	UTSW	19	10916524	missense	probably damaging	1.00
R4420:Zp1	UTSW	19	10914760	splice site	probably null
R4669:Zp1	UTSW	19	10918905	missense	probably benign	0.31
R4849:Zp1	UTSW	19	10918834	missense	possibly damaging	0.90
R5134:Zp1	UTSW	19	10920562	missense	probably benign	0.29
R5510:Zp1	UTSW	19	10919405	missense	probably damaging	1.00
R6284:Zp1	UTSW	19	10916503	missense	probably damaging	1.00
R6307:Zp1	UTSW	19	10916720	missense	probably null	0.45
R6378:Zp1	UTSW	19	10914853	missense	probably benign	0.15
R6608:Zp1	UTSW	19	10918980	missense	possibly damaging	0.93
R6697:Zp1	UTSW	19	10914835	missense	probably benign	0.05
R6862:Zp1	UTSW	19	10916513	missense	possibly damaging	0.84
R7054:Zp1	UTSW	19	10918740	missense	probably damaging	0.98
R7253:Zp1	UTSW	19	10916569	missense	probably damaging	0.99
R7483:Zp1	UTSW	19	10917916	missense	possibly damaging	0.72
R7591:Zp1	UTSW	19	10919471	missense	probably damaging	1.00
Z1176:Zp1	UTSW	19	10917914	missense	probably damaging	1.00
Z1177:Zp1	UTSW	19	10918604	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATTGGGAAGGGTGTCTGCC -3'
(R):5'- TAGACCCAGGATGGAACGTG -3'

Sequencing Primer
(F):5'- AAGGGTGTCTGCCAGCACTC -3'
(R):5'- AGGATGGAACGTGCCTTCTC -3'

Posted On

2016-07-06