Incidental Mutation 'R5170:Zp1'
ID397530
Institutional Source Beutler Lab
Gene Symbol Zp1
Ensembl Gene ENSMUSG00000024734
Gene Namezona pellucida glycoprotein 1
Synonyms
MMRRC Submission 042750-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5170 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location10914287-10920632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 10920554 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 8 (V8F)
Ref Sequence ENSEMBL: ENSMUSP00000025641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025641] [ENSMUST00000168708]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025641
AA Change: V8F

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025641
Gene: ENSMUSG00000024734
AA Change: V8F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
PD 226 269 2.33e-11 SMART
ZP 271 542 1.55e-102 SMART
low complexity region 580 589 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168708
SMART Domains Protein: ENSMUSP00000128543
Gene: ENSMUSG00000024734

DomainStartEndE-ValueType
Pfam:Zona_pellucida 3 61 5.6e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zona pellucida is an extracellular matrix that surrounds the oocyte and early embryo. It is composed primarily of three or four glycoproteins with various functions during fertilization and preimplantation development. The protein encoded by this gene ensures the structural integrity of the zona pellucida. Mutations in this gene are a cause of oocyte maturation defect and infertility. [provided by RefSeq, May 2014]
PHENOTYPE: Female homozygous mutants produce oocytes with abnormal zona pellucida. Fecunditiy is significantly reduced, probably due to precocious hatching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,588,625 I51V probably benign Het
Agbl2 A G 2: 90,803,197 K559R probably benign Het
Arhgap30 A G 1: 171,408,050 D664G probably benign Het
BC034090 A G 1: 155,213,650 V798A probably damaging Het
Bdp1 A T 13: 100,030,794 C2237* probably null Het
C3 C T 17: 57,223,938 V388M probably damaging Het
Ccdc170 G A 10: 4,514,200 E60K probably damaging Het
Cdh8 G A 8: 99,279,550 T135M probably damaging Het
Cep131 G T 11: 120,070,609 A572E probably damaging Het
Clec16a A G 16: 10,741,791 Y976C probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Eno3 A G 11: 70,662,214 I393V probably benign Het
Fbxo47 A G 11: 97,857,694 V305A probably benign Het
Fry G A 5: 150,429,854 V1779M probably benign Het
Gm15293 A T 8: 21,201,680 D26V probably damaging Het
Gtse1 T C 15: 85,864,264 probably null Het
Gucy2e A T 11: 69,235,570 L328Q probably damaging Het
Ifi207 T C 1: 173,730,498 T225A unknown Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Lamc3 A T 2: 31,887,344 M1L probably benign Het
Lman1l G A 9: 57,615,619 R153* probably null Het
Myo16 A G 8: 10,569,745 D1432G probably benign Het
Nwd2 A T 5: 63,806,037 N988I probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp14 T C 16: 35,857,279 E773G probably benign Het
Psen1 T A 12: 83,714,862 M146K probably damaging Het
Ptx4 G A 17: 25,123,178 R209Q probably benign Het
Slc13a2 T C 11: 78,400,808 T340A probably damaging Het
St8sia1 T C 6: 142,963,708 K21E probably damaging Het
Stxbp1 T C 2: 32,794,674 D581G probably benign Het
Sumo2 G A 11: 115,534,660 probably benign Het
Supt5 G A 7: 28,316,083 P910S probably benign Het
Tbc1d30 T C 10: 121,306,838 Q158R possibly damaging Het
Tenm2 T A 11: 36,024,806 H1968L probably damaging Het
Trmt1 T C 8: 84,695,232 Y220H probably damaging Het
Trp73 C T 4: 154,104,838 E60K possibly damaging Het
Ttn A G 2: 76,787,069 Y8026H probably damaging Het
Zar1l A G 5: 150,517,585 probably null Het
Zfp740 T C 15: 102,209,205 Y117H probably damaging Het
Zfp941 G A 7: 140,812,957 probably benign Het
Other mutations in Zp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Zp1 APN 19 10918777 missense probably damaging 1.00
IGL01504:Zp1 APN 19 10919011 missense probably damaging 0.99
IGL02260:Zp1 APN 19 10916714 unclassified probably benign
IGL02465:Zp1 APN 19 10920487 missense probably benign 0.09
IGL02634:Zp1 APN 19 10919507 unclassified probably benign
IGL02714:Zp1 APN 19 10918612 missense probably damaging 1.00
IGL03234:Zp1 APN 19 10914823 splice site probably benign
IGL03404:Zp1 APN 19 10914461 unclassified probably benign
R0504:Zp1 UTSW 19 10916207 missense probably damaging 0.98
R0554:Zp1 UTSW 19 10920562 missense probably benign 0.29
R1028:Zp1 UTSW 19 10918911 missense probably benign 0.01
R1279:Zp1 UTSW 19 10918577 missense probably damaging 1.00
R1460:Zp1 UTSW 19 10918878 missense probably benign
R3425:Zp1 UTSW 19 10918592 missense probably benign 0.00
R3832:Zp1 UTSW 19 10916524 missense probably damaging 1.00
R4420:Zp1 UTSW 19 10914760 splice site probably null
R4669:Zp1 UTSW 19 10918905 missense probably benign 0.31
R4849:Zp1 UTSW 19 10918834 missense possibly damaging 0.90
R5134:Zp1 UTSW 19 10920562 missense probably benign 0.29
R5510:Zp1 UTSW 19 10919405 missense probably damaging 1.00
R6284:Zp1 UTSW 19 10916503 missense probably damaging 1.00
R6307:Zp1 UTSW 19 10916720 missense probably null 0.45
R6378:Zp1 UTSW 19 10914853 missense probably benign 0.15
R6608:Zp1 UTSW 19 10918980 missense possibly damaging 0.93
R6697:Zp1 UTSW 19 10914835 missense probably benign 0.05
R6862:Zp1 UTSW 19 10916513 missense possibly damaging 0.84
R7054:Zp1 UTSW 19 10918740 missense probably damaging 0.98
R7253:Zp1 UTSW 19 10916569 missense probably damaging 0.99
R7483:Zp1 UTSW 19 10917916 missense possibly damaging 0.72
R7591:Zp1 UTSW 19 10919471 missense probably damaging 1.00
Z1176:Zp1 UTSW 19 10917914 missense probably damaging 1.00
Z1177:Zp1 UTSW 19 10918604 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTGGGAAGGGTGTCTGCC -3'
(R):5'- TAGACCCAGGATGGAACGTG -3'

Sequencing Primer
(F):5'- AAGGGTGTCTGCCAGCACTC -3'
(R):5'- AGGATGGAACGTGCCTTCTC -3'
Posted On2016-07-06