Mutagenetix > Incidental Mutations

Incidental Mutation 'R5170:Gtse1'

397523

Institutional Source

Beutler Lab

Gene Symbol

Gtse1

Ensembl Gene

ENSMUSG00000022385

Gene Name

G two S phase expressed protein 1

Synonyms

B99, Gtse-1

MMRRC Submission

042750-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R5170 (G1)

Quality Score

131

Status

Not validated

Chromosome

Chromosomal Location

85859745-85876573 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 85864264 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000155552 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170629] [ENSMUST00000231074]

AlphaFold

Q8R080

Predicted Effect

probably null
Transcript: ENSMUST00000170629

SMART Domains

Protein: ENSMUSP00000128759
Gene: ENSMUSG00000022385

Domain	Start	End	E-Value	Type
Pfam:GTSE1_N	10	153	3e-62	PFAM
low complexity region	284	301	N/A	INTRINSIC
low complexity region	310	321	N/A	INTRINSIC
low complexity region	360	372	N/A	INTRINSIC
low complexity region	478	497	N/A	INTRINSIC
low complexity region	568	593	N/A	INTRINSIC
low complexity region	644	653	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000231074

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is only expressed in the S and G2 phases of the cell cycle, where it colocalizes with cytoplasmic tubulin and microtubules. In response to DNA damage, the encoded protein accumulates in the nucleus and binds the tumor suppressor protein p53, shuttling it out of the nucleus and repressing its ability to induce apoptosis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox3	A	G	5: 35,588,625	I51V	probably benign	Het
Agbl2	A	G	2: 90,803,197	K559R	probably benign	Het
Arhgap30	A	G	1: 171,408,050	D664G	probably benign	Het
BC034090	A	G	1: 155,213,650	V798A	probably damaging	Het
Bdp1	A	T	13: 100,030,794	C2237*	probably null	Het
C3	C	T	17: 57,223,938	V388M	probably damaging	Het
Ccdc170	G	A	10: 4,514,200	E60K	probably damaging	Het
Cdh8	G	A	8: 99,279,550	T135M	probably damaging	Het
Cep131	G	T	11: 120,070,609	A572E	probably damaging	Het
Clec16a	A	G	16: 10,741,791	Y976C	probably benign	Het
Dmpk	C	G	7: 19,088,019	L301V	probably benign	Het
Eno3	A	G	11: 70,662,214	I393V	probably benign	Het
Fbxo47	A	G	11: 97,857,694	V305A	probably benign	Het
Fry	G	A	5: 150,429,854	V1779M	probably benign	Het
Gm15293	A	T	8: 21,201,680	D26V	probably damaging	Het
Gucy2e	A	T	11: 69,235,570	L328Q	probably damaging	Het
Ifi207	T	C	1: 173,730,498	T225A	unknown	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Lamc3	A	T	2: 31,887,344	M1L	probably benign	Het
Lman1l	G	A	9: 57,615,619	R153*	probably null	Het
Myo16	A	G	8: 10,569,745	D1432G	probably benign	Het
Nwd2	A	T	5: 63,806,037	N988I	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Parp14	T	C	16: 35,857,279	E773G	probably benign	Het
Psen1	T	A	12: 83,714,862	M146K	probably damaging	Het
Ptx4	G	A	17: 25,123,178	R209Q	probably benign	Het
Slc13a2	T	C	11: 78,400,808	T340A	probably damaging	Het
St8sia1	T	C	6: 142,963,708	K21E	probably damaging	Het
Stxbp1	T	C	2: 32,794,674	D581G	probably benign	Het
Sumo2	G	A	11: 115,534,660		probably benign	Het
Supt5	G	A	7: 28,316,083	P910S	probably benign	Het
Tbc1d30	T	C	10: 121,306,838	Q158R	possibly damaging	Het
Tenm2	T	A	11: 36,024,806	H1968L	probably damaging	Het
Trmt1	T	C	8: 84,695,232	Y220H	probably damaging	Het
Trp73	C	T	4: 154,104,838	E60K	possibly damaging	Het
Ttn	A	G	2: 76,787,069	Y8026H	probably damaging	Het
Zar1l	A	G	5: 150,517,585		probably null	Het
Zfp740	T	C	15: 102,209,205	Y117H	probably damaging	Het
Zfp941	G	A	7: 140,812,957		probably benign	Het
Zp1	C	A	19: 10,920,554	V8F	possibly damaging	Het

Other mutations in Gtse1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Gtse1	APN	15	85868817	missense	possibly damaging	0.54
IGL01344:Gtse1	APN	15	85862066	critical splice acceptor site	probably null
IGL01541:Gtse1	APN	15	85875654	nonsense	probably null
IGL01621:Gtse1	APN	15	85875082	missense	probably benign	0.01
IGL01945:Gtse1	APN	15	85871547	missense	probably benign	0.00
IGL02193:Gtse1	APN	15	85862330	missense	probably benign	0.27
IGL02215:Gtse1	APN	15	85862598	missense	possibly damaging	0.92
IGL02494:Gtse1	APN	15	85867503	missense	probably damaging	1.00
IGL02879:Gtse1	APN	15	85869063	splice site	probably benign
R0009:Gtse1	UTSW	15	85862435	missense	probably benign	0.06
R0047:Gtse1	UTSW	15	85862378	missense	probably damaging	1.00
R0047:Gtse1	UTSW	15	85862378	missense	probably damaging	1.00
R0576:Gtse1	UTSW	15	85869051	missense	probably damaging	1.00
R1078:Gtse1	UTSW	15	85862307	missense	probably damaging	0.98
R1442:Gtse1	UTSW	15	85860102	splice site	probably benign
R1623:Gtse1	UTSW	15	85867578	missense	probably benign
R1925:Gtse1	UTSW	15	85873738	missense	probably benign	0.00
R1928:Gtse1	UTSW	15	85862063	splice site	probably benign
R4565:Gtse1	UTSW	15	85875184	missense	probably damaging	0.99
R5310:Gtse1	UTSW	15	85873792	missense	probably benign	0.04
R5428:Gtse1	UTSW	15	85862139	missense	probably benign	0.12
R5748:Gtse1	UTSW	15	85867577	missense	probably benign
R5996:Gtse1	UTSW	15	85864180	missense	probably benign	0.00
R6179:Gtse1	UTSW	15	85868957	missense	possibly damaging	0.95
R6379:Gtse1	UTSW	15	85864224	missense	probably benign	0.01
R6381:Gtse1	UTSW	15	85862148	missense	probably benign	0.00
R6434:Gtse1	UTSW	15	85875169	missense	probably benign	0.21
R7086:Gtse1	UTSW	15	85875549	missense	probably damaging	1.00
R7304:Gtse1	UTSW	15	85871547	missense	probably benign	0.00
R7485:Gtse1	UTSW	15	85868700	missense	probably benign	0.04
R7580:Gtse1	UTSW	15	85862231	missense	probably damaging	1.00
R7856:Gtse1	UTSW	15	85864141	missense	probably benign	0.09
R8496:Gtse1	UTSW	15	85862082	missense	probably damaging	1.00
R8674:Gtse1	UTSW	15	85862175	missense	probably damaging	1.00
R8987:Gtse1	UTSW	15	85868908	missense	probably benign	0.00
Z1176:Gtse1	UTSW	15	85868746	missense	possibly damaging	0.85
Z1177:Gtse1	UTSW	15	85875737	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GACCAGGTAGTCTTCACCTCTC -3'
(R):5'- AGTTCACTGCACATGGCCAG -3'

Sequencing Primer
(F):5'- AGGTAGTCTTCACCTCTCAAATCGAC -3'
(R):5'- TCACCAAGTTGGCTAAGCTG -3'

Posted On

2016-07-06