Incidental Mutation 'R5235:Gm4858'
ID398279
Institutional Source Beutler Lab
Gene Symbol Gm4858
Ensembl Gene ENSMUSG00000096879
Gene Namepredicted gene 4858
Synonyms
MMRRC Submission 042807-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.866) question?
Stock #R5235 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location93068823-93075505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93074086 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 137 (D137G)
Ref Sequence ENSEMBL: ENSMUSP00000141677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179064] [ENSMUST00000194595] [ENSMUST00000195847]
Predicted Effect probably damaging
Transcript: ENSMUST00000179064
AA Change: D63G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136458
Gene: ENSMUSG00000096879
AA Change: D63G

DomainStartEndE-ValueType
BTB 62 161 1.73e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194595
AA Change: D63G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141574
Gene: ENSMUSG00000096879
AA Change: D63G

DomainStartEndE-ValueType
BTB 62 161 1.73e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195847
AA Change: D137G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141677
Gene: ENSMUSG00000096879
AA Change: D137G

DomainStartEndE-ValueType
Blast:MATH 1 78 5e-51 BLAST
SCOP:d1czya1 3 99 3e-12 SMART
BTB 136 235 1.1e-26 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C A 7: 41,624,832 H126Q possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aga A G 8: 53,514,326 H124R probably damaging Het
Ank1 G A 8: 23,082,196 G49R probably damaging Het
Aox1 G T 1: 58,057,555 V270L possibly damaging Het
Arfrp1 T C 2: 181,359,505 H145R probably benign Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg3 A G 16: 45,159,157 T20A probably benign Het
C3ar1 A G 6: 122,850,922 L112P probably damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Csmd3 T C 15: 47,629,278 T3156A probably benign Het
Dag1 T C 9: 108,207,698 Y748C probably damaging Het
Dek A T 13: 47,086,479 probably null Het
Fras1 G A 5: 96,600,750 V695M probably benign Het
Gpx7 A G 4: 108,400,992 S135P probably damaging Het
Ido2 A T 8: 24,547,186 I168N probably damaging Het
Lca5 A T 9: 83,423,054 L233* probably null Het
Liph A C 16: 21,984,035 L95V probably damaging Het
Mast1 A T 8: 84,913,439 L1113Q probably damaging Het
Nlrx1 C T 9: 44,263,750 G243D probably damaging Het
Olfr1168 T A 2: 88,185,568 D230E probably benign Het
Olfr1187-ps1 G A 2: 88,540,425 noncoding transcript Het
Otoa T C 7: 121,156,470 L1033P probably damaging Het
Ovol3 A T 7: 30,233,474 Y179N possibly damaging Het
Papss2 A G 19: 32,639,219 N215S probably benign Het
Pcdhga8 T C 18: 37,727,435 Y515H probably damaging Het
Phlda1 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC 10: 111,507,391 probably benign Het
Scn2a A T 2: 65,752,011 N1568Y probably damaging Het
Sec16b A T 1: 157,534,764 I251F probably benign Het
Slc29a4 T A 5: 142,718,768 I355N probably damaging Het
Snx29 G T 16: 11,413,246 C39F possibly damaging Het
Spata16 A G 3: 26,667,632 M101V probably benign Het
Stat2 T C 10: 128,291,032 probably null Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Tpm3 A G 3: 90,086,495 E97G probably damaging Het
Ugt8a A C 3: 125,867,480 H454Q probably damaging Het
Vmn2r27 T A 6: 124,192,054 I706L probably damaging Het
Wdfy3 T C 5: 101,847,106 I3256V probably null Het
Other mutations in Gm4858
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02370:Gm4858 APN 3 93074047 missense possibly damaging 0.61
R1872:Gm4858 UTSW 3 93074422 missense probably damaging 1.00
R1992:Gm4858 UTSW 3 93074037 missense probably benign 0.00
R3799:Gm4858 UTSW 3 93074086 missense probably damaging 1.00
R5045:Gm4858 UTSW 3 93074217 missense probably damaging 1.00
R5819:Gm4858 UTSW 3 93073732 missense probably damaging 1.00
R6928:Gm4858 UTSW 3 93073960 missense probably damaging 1.00
R6937:Gm4858 UTSW 3 93074110 missense probably benign 0.14
R6956:Gm4858 UTSW 3 93073972 missense possibly damaging 0.57
R7228:Gm4858 UTSW 3 93073686 missense possibly damaging 0.96
R7273:Gm4858 UTSW 3 93074168 missense probably damaging 1.00
R7308:Gm4858 UTSW 3 93074565 missense probably benign
R7704:Gm4858 UTSW 3 93074445 missense probably benign
Z1176:Gm4858 UTSW 3 93074055 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGTCTCTAGCCCAAGTGC -3'
(R):5'- CACATCACTGGCCATAGAGTAG -3'

Sequencing Primer
(F):5'- GTGCTAACACCAGATGACAAATTTAC -3'
(R):5'- ATGCCTTCCCAGTGTAGATGAAGC -3'
Posted On2016-07-06