Incidental Mutation 'R5235:Olfr1168'
ID398267
Institutional Source Beutler Lab
Gene Symbol Olfr1168
Ensembl Gene ENSMUSG00000061342
Gene Nameolfactory receptor 1168
SynonymsMOR174-13, GA_x6K02T2Q125-49669483-49670421
MMRRC Submission 042807-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5235 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88181880-88186919 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88185568 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 230 (D230E)
Ref Sequence ENSEMBL: ENSMUSP00000149517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079599] [ENSMUST00000215996]
Predicted Effect probably benign
Transcript: ENSMUST00000079599
AA Change: D230E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078549
Gene: ENSMUSG00000061342
AA Change: D230E

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2e-47 PFAM
Pfam:7tm_1 39 288 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215996
AA Change: D230E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C A 7: 41,624,832 H126Q possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aga A G 8: 53,514,326 H124R probably damaging Het
Ank1 G A 8: 23,082,196 G49R probably damaging Het
Aox1 G T 1: 58,057,555 V270L possibly damaging Het
Arfrp1 T C 2: 181,359,505 H145R probably benign Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg3 A G 16: 45,159,157 T20A probably benign Het
C3ar1 A G 6: 122,850,922 L112P probably damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Csmd3 T C 15: 47,629,278 T3156A probably benign Het
Dag1 T C 9: 108,207,698 Y748C probably damaging Het
Dek A T 13: 47,086,479 probably null Het
Fras1 G A 5: 96,600,750 V695M probably benign Het
Gm4858 A G 3: 93,074,086 D137G probably damaging Het
Gpx7 A G 4: 108,400,992 S135P probably damaging Het
Ido2 A T 8: 24,547,186 I168N probably damaging Het
Lca5 A T 9: 83,423,054 L233* probably null Het
Liph A C 16: 21,984,035 L95V probably damaging Het
Mast1 A T 8: 84,913,439 L1113Q probably damaging Het
Nlrx1 C T 9: 44,263,750 G243D probably damaging Het
Olfr1187-ps1 G A 2: 88,540,425 noncoding transcript Het
Otoa T C 7: 121,156,470 L1033P probably damaging Het
Ovol3 A T 7: 30,233,474 Y179N possibly damaging Het
Papss2 A G 19: 32,639,219 N215S probably benign Het
Pcdhga8 T C 18: 37,727,435 Y515H probably damaging Het
Phlda1 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC 10: 111,507,391 probably benign Het
Scn2a A T 2: 65,752,011 N1568Y probably damaging Het
Sec16b A T 1: 157,534,764 I251F probably benign Het
Slc29a4 T A 5: 142,718,768 I355N probably damaging Het
Snx29 G T 16: 11,413,246 C39F possibly damaging Het
Spata16 A G 3: 26,667,632 M101V probably benign Het
Stat2 T C 10: 128,291,032 probably null Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Tpm3 A G 3: 90,086,495 E97G probably damaging Het
Ugt8a A C 3: 125,867,480 H454Q probably damaging Het
Vmn2r27 T A 6: 124,192,054 I706L probably damaging Het
Wdfy3 T C 5: 101,847,106 I3256V probably null Het
Other mutations in Olfr1168
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:Olfr1168 APN 2 88185285 missense probably benign 0.05
R0079:Olfr1168 UTSW 2 88185354 missense possibly damaging 0.94
R0302:Olfr1168 UTSW 2 88185510 missense possibly damaging 0.95
R0606:Olfr1168 UTSW 2 88185280 missense possibly damaging 0.70
R0973:Olfr1168 UTSW 2 88184978 missense probably benign 0.07
R0973:Olfr1168 UTSW 2 88184978 missense probably benign 0.07
R0974:Olfr1168 UTSW 2 88184978 missense probably benign 0.07
R2140:Olfr1168 UTSW 2 88185095 missense probably benign 0.14
R2261:Olfr1168 UTSW 2 88185621 missense probably damaging 1.00
R6608:Olfr1168 UTSW 2 88185705 missense possibly damaging 0.49
R7323:Olfr1168 UTSW 2 88185608 missense possibly damaging 0.90
R7476:Olfr1168 UTSW 2 88184966 missense probably benign
R7951:Olfr1168 UTSW 2 88185272 missense probably damaging 0.98
Z1176:Olfr1168 UTSW 2 88185071 missense probably damaging 1.00
Z1177:Olfr1168 UTSW 2 88184937 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGGCATCATTGATCACTTTGG -3'
(R):5'- GATGAGCCTCTTGACTGTCTC -3'

Sequencing Primer
(F):5'- GATCACTTTGGCTGTGAATATTCAG -3'
(R):5'- ACATCTTTGTTCCTTAGGCTGTAG -3'
Posted On2016-07-06