Incidental Mutation 'R5235:Slc29a4'
ID398294
Institutional Source Beutler Lab
Gene Symbol Slc29a4
Ensembl Gene ENSMUSG00000050822
Gene Namesolute carrier family 29 (nucleoside transporters), member 4
SynonymsmPMAT, ENT4
MMRRC Submission 042807-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5235 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location142692512-142722490 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 142718768 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 355 (I355N)
Ref Sequence ENSEMBL: ENSMUSP00000059896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058418]
Predicted Effect probably damaging
Transcript: ENSMUST00000058418
AA Change: I355N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000059896
Gene: ENSMUSG00000050822
AA Change: I355N

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Nucleoside_tran 170 501 2e-51 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC29A/ENT transporter protein family. The encoded membrane protein catalyzes the reuptake of monoamines into presynaptic neurons, thus determining the intensity and duration of monoamine neural signaling. It has been shown to transport several compounds, including serotonin, dopamine, and the neurotoxin 1-methyl-4-phenylpyridinium. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired organic cation and monoamine uptake in the choroid plexus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C A 7: 41,624,832 H126Q possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aga A G 8: 53,514,326 H124R probably damaging Het
Ank1 G A 8: 23,082,196 G49R probably damaging Het
Aox1 G T 1: 58,057,555 V270L possibly damaging Het
Arfrp1 T C 2: 181,359,505 H145R probably benign Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg3 A G 16: 45,159,157 T20A probably benign Het
C3ar1 A G 6: 122,850,922 L112P probably damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Csmd3 T C 15: 47,629,278 T3156A probably benign Het
Dag1 T C 9: 108,207,698 Y748C probably damaging Het
Dek A T 13: 47,086,479 probably null Het
Fras1 G A 5: 96,600,750 V695M probably benign Het
Gm4858 A G 3: 93,074,086 D137G probably damaging Het
Gpx7 A G 4: 108,400,992 S135P probably damaging Het
Ido2 A T 8: 24,547,186 I168N probably damaging Het
Lca5 A T 9: 83,423,054 L233* probably null Het
Liph A C 16: 21,984,035 L95V probably damaging Het
Mast1 A T 8: 84,913,439 L1113Q probably damaging Het
Nlrx1 C T 9: 44,263,750 G243D probably damaging Het
Olfr1168 T A 2: 88,185,568 D230E probably benign Het
Olfr1187-ps1 G A 2: 88,540,425 noncoding transcript Het
Otoa T C 7: 121,156,470 L1033P probably damaging Het
Ovol3 A T 7: 30,233,474 Y179N possibly damaging Het
Papss2 A G 19: 32,639,219 N215S probably benign Het
Pcdhga8 T C 18: 37,727,435 Y515H probably damaging Het
Phlda1 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC 10: 111,507,391 probably benign Het
Scn2a A T 2: 65,752,011 N1568Y probably damaging Het
Sec16b A T 1: 157,534,764 I251F probably benign Het
Snx29 G T 16: 11,413,246 C39F possibly damaging Het
Spata16 A G 3: 26,667,632 M101V probably benign Het
Stat2 T C 10: 128,291,032 probably null Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Tpm3 A G 3: 90,086,495 E97G probably damaging Het
Ugt8a A C 3: 125,867,480 H454Q probably damaging Het
Vmn2r27 T A 6: 124,192,054 I706L probably damaging Het
Wdfy3 T C 5: 101,847,106 I3256V probably null Het
Other mutations in Slc29a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Slc29a4 APN 5 142705530 missense probably benign 0.02
IGL01717:Slc29a4 APN 5 142718746 missense probably damaging 1.00
IGL02184:Slc29a4 APN 5 142717751 missense probably damaging 1.00
IGL02207:Slc29a4 APN 5 142718885 missense possibly damaging 0.76
IGL02210:Slc29a4 APN 5 142718779 missense probably damaging 1.00
IGL02323:Slc29a4 APN 5 142717652 missense probably damaging 0.99
IGL02381:Slc29a4 APN 5 142720099 missense probably benign 0.34
IGL03103:Slc29a4 APN 5 142712080 missense probably damaging 1.00
IGL03210:Slc29a4 APN 5 142715108 missense probably damaging 1.00
R0131:Slc29a4 UTSW 5 142705530 missense probably benign 0.02
R0131:Slc29a4 UTSW 5 142705530 missense probably benign 0.02
R0132:Slc29a4 UTSW 5 142705530 missense probably benign 0.02
R0850:Slc29a4 UTSW 5 142718572 missense probably benign 0.00
R1777:Slc29a4 UTSW 5 142714062 missense probably damaging 0.96
R1864:Slc29a4 UTSW 5 142717754 missense probably damaging 1.00
R1870:Slc29a4 UTSW 5 142721488 makesense probably null
R1871:Slc29a4 UTSW 5 142721488 makesense probably null
R2092:Slc29a4 UTSW 5 142718855 missense probably damaging 1.00
R2196:Slc29a4 UTSW 5 142712895 missense possibly damaging 0.94
R4716:Slc29a4 UTSW 5 142718572 missense probably benign 0.00
R5002:Slc29a4 UTSW 5 142718746 missense probably damaging 1.00
R5162:Slc29a4 UTSW 5 142721452 missense possibly damaging 0.80
R5553:Slc29a4 UTSW 5 142720036 missense probably damaging 1.00
R5642:Slc29a4 UTSW 5 142711972 missense probably damaging 1.00
R5688:Slc29a4 UTSW 5 142714098 missense possibly damaging 0.68
R5930:Slc29a4 UTSW 5 142721402 missense possibly damaging 0.90
R5944:Slc29a4 UTSW 5 142718818 missense probably damaging 1.00
R6056:Slc29a4 UTSW 5 142720077 missense probably damaging 0.99
R6409:Slc29a4 UTSW 5 142712071 missense probably damaging 1.00
R6934:Slc29a4 UTSW 5 142712958 missense probably benign 0.02
R7508:Slc29a4 UTSW 5 142718506 missense probably benign 0.00
R7509:Slc29a4 UTSW 5 142718506 missense probably benign 0.00
R7716:Slc29a4 UTSW 5 142718506 missense probably benign 0.00
R7910:Slc29a4 UTSW 5 142705401 missense probably benign 0.00
R8408:Slc29a4 UTSW 5 142705354 critical splice acceptor site probably null
R8411:Slc29a4 UTSW 5 142720125 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTGATACTGTGGAGTCCG -3'
(R):5'- GGTGACACTCATGGCTACCATTC -3'

Sequencing Primer
(F):5'- ATACTGTGGAGTCCGGTGGC -3'
(R):5'- TGGCTTTGCTCCAGAAAGAC -3'
Posted On2016-07-06