Incidental Mutation 'R5235:Ovol3'
ID398298
Institutional Source Beutler Lab
Gene Symbol Ovol3
Ensembl Gene ENSMUSG00000100512
Gene Nameovo like zinc finger 3
Synonymsmovo3, LOC381867
MMRRC Submission 042807-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R5235 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30233439-30235725 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30233474 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 179 (Y179N)
Ref Sequence ENSEMBL: ENSMUSP00000140811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006254] [ENSMUST00000019882] [ENSMUST00000108192] [ENSMUST00000108193] [ENSMUST00000149654] [ENSMUST00000189482]
Predicted Effect probably benign
Transcript: ENSMUST00000006254
SMART Domains Protein: ENSMUSP00000006254
Gene: ENSMUSG00000006095

DomainStartEndE-ValueType
Pfam:Ubiquitin_2 10 94 9.6e-30 PFAM
low complexity region 135 152 N/A INTRINSIC
CAP_GLY 161 230 4.76e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019882
SMART Domains Protein: ENSMUSP00000019882
Gene: ENSMUSG00000019738

DomainStartEndE-ValueType
RPOL9 15 68 1.22e-24 SMART
ZnF_C2C2 84 125 2.18e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108192
SMART Domains Protein: ENSMUSP00000103827
Gene: ENSMUSG00000019738

DomainStartEndE-ValueType
RPOL9 1 46 5.45e-13 SMART
ZnF_C2C2 62 103 2.18e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108193
SMART Domains Protein: ENSMUSP00000103828
Gene: ENSMUSG00000019738

DomainStartEndE-ValueType
Pfam:RNA_POL_M_15KD 14 41 1.8e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145559
Predicted Effect probably benign
Transcript: ENSMUST00000149654
SMART Domains Protein: ENSMUSP00000116741
Gene: ENSMUSG00000019738

DomainStartEndE-ValueType
RPOL9 1 46 5.45e-13 SMART
Blast:ZnF_C2C2 62 83 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150841
Predicted Effect possibly damaging
Transcript: ENSMUST00000189482
AA Change: Y179N

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140811
Gene: ENSMUSG00000100512
AA Change: Y179N

DomainStartEndE-ValueType
ZnF_C2H2 69 91 3.2e-4 SMART
ZnF_C2H2 97 119 1.4e-6 SMART
ZnF_C2H2 125 148 3.2e-5 SMART
ZnF_C2H2 164 186 5.3e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C A 7: 41,624,832 H126Q possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aga A G 8: 53,514,326 H124R probably damaging Het
Ank1 G A 8: 23,082,196 G49R probably damaging Het
Aox1 G T 1: 58,057,555 V270L possibly damaging Het
Arfrp1 T C 2: 181,359,505 H145R probably benign Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg3 A G 16: 45,159,157 T20A probably benign Het
C3ar1 A G 6: 122,850,922 L112P probably damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Csmd3 T C 15: 47,629,278 T3156A probably benign Het
Dag1 T C 9: 108,207,698 Y748C probably damaging Het
Dek A T 13: 47,086,479 probably null Het
Fras1 G A 5: 96,600,750 V695M probably benign Het
Gm4858 A G 3: 93,074,086 D137G probably damaging Het
Gpx7 A G 4: 108,400,992 S135P probably damaging Het
Ido2 A T 8: 24,547,186 I168N probably damaging Het
Lca5 A T 9: 83,423,054 L233* probably null Het
Liph A C 16: 21,984,035 L95V probably damaging Het
Mast1 A T 8: 84,913,439 L1113Q probably damaging Het
Nlrx1 C T 9: 44,263,750 G243D probably damaging Het
Olfr1168 T A 2: 88,185,568 D230E probably benign Het
Olfr1187-ps1 G A 2: 88,540,425 noncoding transcript Het
Otoa T C 7: 121,156,470 L1033P probably damaging Het
Papss2 A G 19: 32,639,219 N215S probably benign Het
Pcdhga8 T C 18: 37,727,435 Y515H probably damaging Het
Phlda1 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC 10: 111,507,391 probably benign Het
Scn2a A T 2: 65,752,011 N1568Y probably damaging Het
Sec16b A T 1: 157,534,764 I251F probably benign Het
Slc29a4 T A 5: 142,718,768 I355N probably damaging Het
Snx29 G T 16: 11,413,246 C39F possibly damaging Het
Spata16 A G 3: 26,667,632 M101V probably benign Het
Stat2 T C 10: 128,291,032 probably null Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Tpm3 A G 3: 90,086,495 E97G probably damaging Het
Ugt8a A C 3: 125,867,480 H454Q probably damaging Het
Vmn2r27 T A 6: 124,192,054 I706L probably damaging Het
Wdfy3 T C 5: 101,847,106 I3256V probably null Het
Other mutations in Ovol3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4425:Ovol3 UTSW 7 30235364 critical splice donor site probably null
R5331:Ovol3 UTSW 7 30233479 missense possibly damaging 0.57
R6050:Ovol3 UTSW 7 30234394 missense probably benign
R6454:Ovol3 UTSW 7 30235375 missense probably damaging 1.00
R7329:Ovol3 UTSW 7 30235252 missense probably benign 0.01
R7438:Ovol3 UTSW 7 30235221 critical splice donor site probably null
R7566:Ovol3 UTSW 7 30234366 missense probably damaging 1.00
R8087:Ovol3 UTSW 7 30234372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACCCTGACTGAACGTTC -3'
(R):5'- GCTCATCTTAACAGGAATACGGC -3'

Sequencing Primer
(F):5'- TATTGCTAGGACGCCATGC -3'
(R):5'- TCTTAACAGGAATACGGCCATTC -3'
Posted On2016-07-06