Incidental Mutation 'R5235:Mast1'
ID398307
Institutional Source Beutler Lab
Gene Symbol Mast1
Ensembl Gene ENSMUSG00000053693
Gene Namemicrotubule associated serine/threonine kinase 1
SynonymsSAST170, SAST, 9430008B02Rik
MMRRC Submission 042807-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5235 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location84911903-84937359 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84913439 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1113 (L1113Q)
Ref Sequence ENSEMBL: ENSMUSP00000105363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003910] [ENSMUST00000109741] [ENSMUST00000109744] [ENSMUST00000119820] [ENSMUST00000134569] [ENSMUST00000145292]
Predicted Effect probably benign
Transcript: ENSMUST00000003910
SMART Domains Protein: ENSMUSP00000003910
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 21 349 5.8e-116 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109741
AA Change: L1113Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693
AA Change: L1113Q

DomainStartEndE-ValueType
Pfam:DUF1908 61 337 1.4e-136 PFAM
S_TKc 376 649 4.07e-97 SMART
S_TK_X 650 710 6.23e-2 SMART
low complexity region 820 836 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 933 961 N/A INTRINSIC
PDZ 977 1057 3.49e-14 SMART
low complexity region 1104 1132 N/A INTRINSIC
low complexity region 1149 1174 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1243 1252 N/A INTRINSIC
low complexity region 1479 1492 N/A INTRINSIC
low complexity region 1519 1535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109744
SMART Domains Protein: ENSMUSP00000105366
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
Pfam:DNase_II 9 328 4.8e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119820
SMART Domains Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693

DomainStartEndE-ValueType
Pfam:DUF1908 61 338 5.1e-148 PFAM
S_TKc 376 644 2.79e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128400
Predicted Effect probably benign
Transcript: ENSMUST00000134569
SMART Domains Protein: ENSMUSP00000117198
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 20 119 6.6e-32 PFAM
Pfam:DNase_II 115 182 4.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135219
Predicted Effect probably benign
Transcript: ENSMUST00000145292
SMART Domains Protein: ENSMUSP00000138203
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 20 97 2.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155942
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C A 7: 41,624,832 H126Q possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aga A G 8: 53,514,326 H124R probably damaging Het
Ank1 G A 8: 23,082,196 G49R probably damaging Het
Aox1 G T 1: 58,057,555 V270L possibly damaging Het
Arfrp1 T C 2: 181,359,505 H145R probably benign Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg3 A G 16: 45,159,157 T20A probably benign Het
C3ar1 A G 6: 122,850,922 L112P probably damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Csmd3 T C 15: 47,629,278 T3156A probably benign Het
Dag1 T C 9: 108,207,698 Y748C probably damaging Het
Dek A T 13: 47,086,479 probably null Het
Fras1 G A 5: 96,600,750 V695M probably benign Het
Gm4858 A G 3: 93,074,086 D137G probably damaging Het
Gpx7 A G 4: 108,400,992 S135P probably damaging Het
Ido2 A T 8: 24,547,186 I168N probably damaging Het
Lca5 A T 9: 83,423,054 L233* probably null Het
Liph A C 16: 21,984,035 L95V probably damaging Het
Nlrx1 C T 9: 44,263,750 G243D probably damaging Het
Olfr1168 T A 2: 88,185,568 D230E probably benign Het
Olfr1187-ps1 G A 2: 88,540,425 noncoding transcript Het
Otoa T C 7: 121,156,470 L1033P probably damaging Het
Ovol3 A T 7: 30,233,474 Y179N possibly damaging Het
Papss2 A G 19: 32,639,219 N215S probably benign Het
Pcdhga8 T C 18: 37,727,435 Y515H probably damaging Het
Phlda1 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC 10: 111,507,391 probably benign Het
Scn2a A T 2: 65,752,011 N1568Y probably damaging Het
Sec16b A T 1: 157,534,764 I251F probably benign Het
Slc29a4 T A 5: 142,718,768 I355N probably damaging Het
Snx29 G T 16: 11,413,246 C39F possibly damaging Het
Spata16 A G 3: 26,667,632 M101V probably benign Het
Stat2 T C 10: 128,291,032 probably null Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Tpm3 A G 3: 90,086,495 E97G probably damaging Het
Ugt8a A C 3: 125,867,480 H454Q probably damaging Het
Vmn2r27 T A 6: 124,192,054 I706L probably damaging Het
Wdfy3 T C 5: 101,847,106 I3256V probably null Het
Other mutations in Mast1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Mast1 APN 8 84912815 missense possibly damaging 0.87
IGL01862:Mast1 APN 8 84913246 splice site probably null
IGL01918:Mast1 APN 8 84921209 missense probably damaging 1.00
IGL02212:Mast1 APN 8 84921397 missense probably damaging 1.00
IGL02221:Mast1 APN 8 84918755 missense possibly damaging 0.92
IGL02370:Mast1 APN 8 84912254 missense probably benign
IGL02470:Mast1 APN 8 84921212 missense probably damaging 1.00
IGL02596:Mast1 APN 8 84917771 missense probably benign
IGL02716:Mast1 APN 8 84935723 missense probably damaging 1.00
IGL02987:Mast1 APN 8 84925719 missense possibly damaging 0.75
IGL03287:Mast1 APN 8 84913353 missense probably benign 0.01
R0255:Mast1 UTSW 8 84912021 missense probably benign
R0388:Mast1 UTSW 8 84915537 missense probably benign 0.13
R0480:Mast1 UTSW 8 84913089 missense probably damaging 0.99
R0727:Mast1 UTSW 8 84921415 missense probably damaging 1.00
R1175:Mast1 UTSW 8 84925327 missense probably benign 0.29
R1297:Mast1 UTSW 8 84912716 missense probably benign 0.05
R1328:Mast1 UTSW 8 84917988 intron probably benign
R1454:Mast1 UTSW 8 84920635 missense probably damaging 1.00
R1532:Mast1 UTSW 8 84928609 nonsense probably null
R1752:Mast1 UTSW 8 84925336 missense probably benign
R1777:Mast1 UTSW 8 84912068 missense probably benign
R1905:Mast1 UTSW 8 84916266 missense probably damaging 1.00
R1906:Mast1 UTSW 8 84916266 missense probably damaging 1.00
R1907:Mast1 UTSW 8 84916266 missense probably damaging 1.00
R2056:Mast1 UTSW 8 84920366 missense possibly damaging 0.95
R2071:Mast1 UTSW 8 84921194 missense probably damaging 1.00
R2145:Mast1 UTSW 8 84921478 missense probably damaging 1.00
R2318:Mast1 UTSW 8 84921125 missense probably damaging 1.00
R2842:Mast1 UTSW 8 84923908 missense probably damaging 1.00
R3870:Mast1 UTSW 8 84918731 missense probably damaging 1.00
R3895:Mast1 UTSW 8 84935723 missense probably damaging 1.00
R3973:Mast1 UTSW 8 84918764 missense probably damaging 1.00
R4405:Mast1 UTSW 8 84920891 missense probably damaging 1.00
R4533:Mast1 UTSW 8 84921361 missense probably damaging 1.00
R4725:Mast1 UTSW 8 84929006 missense possibly damaging 0.93
R4770:Mast1 UTSW 8 84929246 missense probably benign 0.02
R4776:Mast1 UTSW 8 84937193 critical splice donor site probably null
R4835:Mast1 UTSW 8 84923779 missense probably damaging 1.00
R4871:Mast1 UTSW 8 84920658 missense probably damaging 1.00
R4953:Mast1 UTSW 8 84918728 missense probably damaging 0.99
R4960:Mast1 UTSW 8 84917871 missense probably benign
R4978:Mast1 UTSW 8 84935787 missense probably damaging 0.98
R5164:Mast1 UTSW 8 84913518 unclassified probably benign
R5297:Mast1 UTSW 8 84913318 critical splice donor site probably null
R5463:Mast1 UTSW 8 84925507 missense probably damaging 1.00
R5546:Mast1 UTSW 8 84916260 missense probably damaging 1.00
R5651:Mast1 UTSW 8 84928968 nonsense probably null
R6124:Mast1 UTSW 8 84925307 missense probably benign 0.01
R6213:Mast1 UTSW 8 84915569 missense probably damaging 1.00
R6717:Mast1 UTSW 8 84917754 missense probably benign
R7000:Mast1 UTSW 8 84928969 missense probably damaging 1.00
R7011:Mast1 UTSW 8 84911945 nonsense probably null
R7164:Mast1 UTSW 8 84935304 missense possibly damaging 0.81
R7695:Mast1 UTSW 8 84920928 missense probably damaging 1.00
R7845:Mast1 UTSW 8 84925325 nonsense probably null
R7882:Mast1 UTSW 8 84913318 critical splice donor site probably null
R8167:Mast1 UTSW 8 84921358 missense probably damaging 1.00
R8197:Mast1 UTSW 8 84912821 missense possibly damaging 0.90
X0066:Mast1 UTSW 8 84920878 missense probably damaging 1.00
Z1176:Mast1 UTSW 8 84912459 missense probably damaging 0.97
Z1176:Mast1 UTSW 8 84918681 missense probably damaging 1.00
Z1177:Mast1 UTSW 8 84920446 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATTAGGCGTGCTGGAAGCTG -3'
(R):5'- TACTGCCTAGTCTAGAACCGG -3'

Sequencing Primer
(F):5'- GGTGCAAACATTCTGAGCAC -3'
(R):5'- CTAGTCTAGAACCGGGGTGG -3'
Posted On2016-07-06