Incidental Mutation 'R5199:Adam1a'
ID400571
Institutional Source Beutler Lab
Gene Symbol Adam1a
Ensembl Gene ENSMUSG00000072647
Gene Namea disintegrin and metallopeptidase domain 1a
Synonymsfertilin alpha, Ftna, PH-30 alpha
MMRRC Submission 042775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5199 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location121518576-121545482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121521152 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 26 (E26G)
Ref Sequence ENSEMBL: ENSMUSP00000098320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031410] [ENSMUST00000100757] [ENSMUST00000111782] [ENSMUST00000111783] [ENSMUST00000111786] [ENSMUST00000111795] [ENSMUST00000125946] [ENSMUST00000156080] [ENSMUST00000200170]
Predicted Effect probably benign
Transcript: ENSMUST00000031410
SMART Domains Protein: ENSMUSP00000031410
Gene: ENSMUSG00000029454

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
coiled coil region 409 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100757
AA Change: E26G

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000098320
Gene: ENSMUSG00000072647
AA Change: E26G

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 70 191 1.5e-18 PFAM
Pfam:Reprolysin_5 233 410 2.8e-15 PFAM
Pfam:Reprolysin_4 234 421 6.3e-9 PFAM
Pfam:Reprolysin 235 429 1.3e-70 PFAM
Pfam:Reprolysin_3 255 381 3.8e-14 PFAM
Pfam:Reprolysin_2 255 419 5.6e-9 PFAM
DISIN 447 520 6.45e-37 SMART
ACR 521 660 4.59e-62 SMART
EGF 666 697 1.99e1 SMART
transmembrane domain 741 763 N/A INTRINSIC
low complexity region 764 791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111781
SMART Domains Protein: ENSMUSP00000107411
Gene: ENSMUSG00000029454

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 200 1.9e-15 PFAM
Pfam:Pkinase 1 203 1.2e-48 PFAM
coiled coil region 308 333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111782
SMART Domains Protein: ENSMUSP00000107412
Gene: ENSMUSG00000029454

DomainStartEndE-ValueType
Pfam:Pkinase 6 155 3.7e-27 PFAM
coiled coil region 258 283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111783
SMART Domains Protein: ENSMUSP00000107413
Gene: ENSMUSG00000029454

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111786
SMART Domains Protein: ENSMUSP00000107416
Gene: ENSMUSG00000029454

DomainStartEndE-ValueType
Pfam:Pkinase 6 155 3.8e-27 PFAM
coiled coil region 260 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111795
SMART Domains Protein: ENSMUSP00000144614
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125946
SMART Domains Protein: ENSMUSP00000142503
Gene: ENSMUSG00000105340

DomainStartEndE-ValueType
S_TKc 22 304 5.3e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128782
Predicted Effect probably benign
Transcript: ENSMUST00000152270
SMART Domains Protein: ENSMUSP00000116464
Gene: ENSMUSG00000029454

DomainStartEndE-ValueType
coiled coil region 49 74 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153763
SMART Domains Protein: ENSMUSP00000119182
Gene: ENSMUSG00000029454

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156080
SMART Domains Protein: ENSMUSP00000121579
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200170
SMART Domains Protein: ENSMUSP00000143668
Gene: ENSMUSG00000072647

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Homozygous null mice display male infertility with asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar T A 3: 89,745,944 M797K probably damaging Het
Amdhd1 A T 10: 93,525,985 C352S probably damaging Het
AW554918 C A 18: 25,340,299 R387S probably damaging Het
C130079G13Rik T C 3: 59,936,485 L200P probably damaging Het
Cabp1 A G 5: 115,186,043 V5A possibly damaging Het
Carmil1 A G 13: 24,111,870 L387P probably damaging Het
Cds2 T A 2: 132,298,483 H200Q probably damaging Het
Cep170b T A 12: 112,744,147 L1470Q probably damaging Het
Cnnm1 A G 19: 43,494,986 D956G possibly damaging Het
Cnot8 C T 11: 58,115,274 Q210* probably null Het
Cpne8 G A 15: 90,648,609 T65I probably benign Het
Crygn A G 5: 24,756,158 V50A probably damaging Het
Cxcr4 A G 1: 128,589,546 V126A probably damaging Het
Cyp4f15 A G 17: 32,702,372 D464G probably benign Het
Dapp1 C T 3: 137,981,385 S12N probably benign Het
Dhps G A 8: 85,073,406 G162R probably damaging Het
Dsp T G 13: 38,192,902 Y1554* probably null Het
Etl4 G T 2: 20,744,042 R397L probably damaging Het
Ezh2 C T 6: 47,551,725 C291Y probably benign Het
Gbp9 T C 5: 105,083,812 S303G probably benign Het
Gm11444 A C 11: 85,848,019 S83A unknown Het
Gm156 T A 6: 129,775,818 Y8F possibly damaging Het
Gpat4 A G 8: 23,182,696 V46A possibly damaging Het
Haus6 T C 4: 86,582,985 D883G possibly damaging Het
Hinfp T C 9: 44,296,392 E439G probably benign Het
Ifna14 T A 4: 88,571,362 Y146F probably damaging Het
Igkv3-3 A T 6: 70,687,504 Y110F probably damaging Het
Kansl2-ps A G 7: 72,673,194 noncoding transcript Het
Mcmdc2 T C 1: 9,920,435 V279A probably benign Het
Mug2 T A 6: 122,040,660 V452D probably benign Het
Ndufb3 C G 1: 58,591,122 probably benign Het
Oas1d G T 5: 120,919,145 K271N probably benign Het
Olfr1012 A G 2: 85,760,214 L54P probably damaging Het
Olfr1215 T A 2: 89,001,763 H175L possibly damaging Het
Olfr203 T A 16: 59,303,740 F196I probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcnt T A 10: 76,418,544 H817L probably benign Het
Per3 G T 4: 151,012,895 S724R probably benign Het
Phlpp1 T A 1: 106,173,394 V464E probably damaging Het
Psme4 A G 11: 30,853,272 E38G probably benign Het
Qtrt2 T C 16: 43,867,425 N264S probably benign Het
Ranbp2 G A 10: 58,464,443 R557H probably benign Het
Rptor T A 11: 119,603,816 S3T probably benign Het
Saxo1 T A 4: 86,487,782 Y60F probably damaging Het
St3gal1 A G 15: 67,113,715 V30A probably benign Het
Tmem245 G A 4: 56,925,149 S324L probably benign Het
Topbp1 A G 9: 103,346,672 probably benign Het
Urb1 T C 16: 90,792,748 T382A possibly damaging Het
Vmn1r178 A T 7: 23,894,389 L214F probably benign Het
Vmn2r82 G A 10: 79,396,087 C640Y probably damaging Het
Vsx2 A G 12: 84,593,210 D281G probably benign Het
Zfp804b A T 5: 6,770,013 C1017S probably benign Het
Other mutations in Adam1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Adam1a APN 5 121519376 missense probably benign 0.09
IGL01467:Adam1a APN 5 121519728 missense probably damaging 1.00
IGL02158:Adam1a APN 5 121518971 nonsense probably null
R1468:Adam1a UTSW 5 121519776 intron probably null
R1468:Adam1a UTSW 5 121519776 intron probably null
R1593:Adam1a UTSW 5 121519643 missense probably benign 0.02
R1848:Adam1a UTSW 5 121519620 missense probably damaging 1.00
R1925:Adam1a UTSW 5 121519450 nonsense probably null
R2176:Adam1a UTSW 5 121519586 missense probably benign 0.01
R2232:Adam1a UTSW 5 121519732 missense possibly damaging 0.93
R3692:Adam1a UTSW 5 121519322 missense probably damaging 1.00
R4732:Adam1a UTSW 5 121519434 missense probably benign 0.34
R4733:Adam1a UTSW 5 121519434 missense probably benign 0.34
R4835:Adam1a UTSW 5 121519689 missense probably damaging 1.00
R6026:Adam1a UTSW 5 121519362 missense probably damaging 1.00
R6936:Adam1a UTSW 5 121519362 missense probably damaging 1.00
R7016:Adam1a UTSW 5 121521038 missense probably benign 0.01
R7124:Adam1a UTSW 5 121519334 missense probably benign 0.15
R7294:Adam1a UTSW 5 121520005 nonsense probably null
R7501:Adam1a UTSW 5 121518948 missense possibly damaging 0.85
R7641:Adam1a UTSW 5 121519307 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATCAATAGCATGTAGGACACC -3'
(R):5'- CACAGTTTCTTGGGAAGCTCC -3'

Sequencing Primer
(F):5'- CTTGCCTGGCAGTCTCTCAGG -3'
(R):5'- GAAGCTCCCCAGTAAGGC -3'
Posted On2016-07-06