Incidental Mutation 'R5216:Abcb1b'
ID403470
Institutional Source Beutler Lab
Gene Symbol Abcb1b
Ensembl Gene ENSMUSG00000028970
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 1B
SynonymsPgy-1, Abcb1, Mdr1, mdr, Pgy1, Mdr1b
MMRRC Submission 042789-MU
Accession Numbers

Genbank: NM_011075; MGI: 97568  

Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R5216 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location8798147-8866315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8813705 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 220 (V220A)
Ref Sequence ENSEMBL: ENSMUSP00000009058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009058] [ENSMUST00000196580] [ENSMUST00000199955]
Predicted Effect probably benign
Transcript: ENSMUST00000009058
AA Change: V220A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000009058
Gene: ENSMUSG00000028970
AA Change: V220A

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Pfam:ABC_membrane 50 342 1.4e-96 PFAM
AAA 418 610 4.32e-21 SMART
Pfam:ABC_membrane 709 984 1.9e-75 PFAM
AAA 1060 1248 4.13e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196580
SMART Domains Protein: ENSMUSP00000143612
Gene: ENSMUSG00000028970

DomainStartEndE-ValueType
PDB:4M2T|B 1 78 2e-26 PDB
Blast:AAA 33 78 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199955
SMART Domains Protein: ENSMUSP00000143766
Gene: ENSMUSG00000028970

DomainStartEndE-ValueType
PDB:4M2T|B 1 78 2e-26 PDB
Blast:AAA 33 78 2e-11 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This gene encodes a membrane glycoprotein which confers a multidrug-resistance phenotype. The protein encoded by the human gene is an ATP-dependent drug efflux pump for xenobiotic compounds which is responsible for decreased drug accumulation in multidrug-resistant cells and mediates the development of resistance to anticancer drugs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are hypersensitive to effects of drugs transported by phosphoglycoproteins. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(2) Gene trapped(8)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,061,162 V84D probably damaging Het
Actg1 A T 11: 120,347,754 M82K probably damaging Het
Ahi1 T C 10: 20,960,076 S103P probably benign Het
Aldh1b1 G T 4: 45,803,652 G397C probably damaging Het
Arhgef3 A G 14: 27,401,842 T507A probably benign Het
Atg7 A G 6: 114,724,949 D682G probably damaging Het
Atp13a3 A G 16: 30,340,284 I783T probably damaging Het
Atp9a T C 2: 168,674,888 I362V probably benign Het
BC067074 G A 13: 113,342,413 C1497Y probably benign Het
Birc6 T A 17: 74,613,470 I168K probably damaging Het
Brca2 T A 5: 150,542,980 Y2070N probably damaging Het
Cabp7 A G 11: 4,738,873 I199T probably damaging Het
Cacng5 A G 11: 107,877,489 F231L possibly damaging Het
Cngb3 T A 4: 19,415,729 V413D possibly damaging Het
Col24a1 G A 3: 145,315,310 E481K possibly damaging Het
Ctr9 T A 7: 111,045,458 I560N possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Fat3 T C 9: 16,377,537 D230G probably damaging Het
Gramd4 G A 15: 86,134,785 probably null Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Hoxd1 A T 2: 74,764,351 N317Y probably damaging Het
Kcnc4 A G 3: 107,439,441 S623P probably benign Het
Klhl20 A G 1: 161,093,679 probably null Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lpin2 C T 17: 71,242,760 S640L probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Mgll T A 6: 88,766,329 C110* probably null Het
Mmp14 A G 14: 54,437,663 N251D possibly damaging Het
Olfr393 A T 11: 73,847,436 S230T probably damaging Het
Olfr552 A G 7: 102,604,821 T156A probably benign Het
Olfr857 T A 9: 19,713,289 V154E probably benign Het
Pfkl T G 10: 78,009,670 D5A probably damaging Het
Pik3c3 A G 18: 30,272,976 Y9C probably damaging Het
Pkhd1l1 T A 15: 44,495,647 Y417* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sulf1 T A 1: 12,796,874 M94K probably benign Het
Synrg A G 11: 83,982,196 T157A probably damaging Het
Syt1 T C 10: 108,642,257 N102S probably benign Het
Tnip2 C T 5: 34,503,805 R101H probably damaging Het
Trmt2a A G 16: 18,252,184 D421G probably benign Het
Vmn1r67 A G 7: 10,447,163 D57G probably benign Het
Wnt2b A G 3: 104,961,345 L43P possibly damaging Het
Zfp113 C T 5: 138,150,715 D56N probably damaging Het
Zfp184 C T 13: 21,950,236 L69F probably damaging Het
Zyx T C 6: 42,356,532 V464A probably damaging Het
Other mutations in Abcb1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Abcb1b APN 5 8827704 missense probably benign 0.34
IGL00979:Abcb1b APN 5 8825293 splice site probably benign
IGL02157:Abcb1b APN 5 8805487 splice site probably benign
IGL02478:Abcb1b APN 5 8806018 missense probably damaging 0.98
IGL03174:Abcb1b APN 5 8827752 missense probably benign 0.03
IGL03189:Abcb1b APN 5 8845814 missense probably benign
IGL03195:Abcb1b APN 5 8853607 missense possibly damaging 0.83
PIT4283001:Abcb1b UTSW 5 8813693 missense probably damaging 1.00
R0049:Abcb1b UTSW 5 8825661 missense probably damaging 1.00
R0166:Abcb1b UTSW 5 8853468 missense probably damaging 1.00
R0254:Abcb1b UTSW 5 8827409 missense probably benign
R0319:Abcb1b UTSW 5 8827428 missense probably benign 0.01
R0358:Abcb1b UTSW 5 8821423 missense probably benign 0.16
R0365:Abcb1b UTSW 5 8806009 missense probably damaging 1.00
R0408:Abcb1b UTSW 5 8853446 missense probably damaging 0.98
R0521:Abcb1b UTSW 5 8864238 missense probably damaging 1.00
R0533:Abcb1b UTSW 5 8864113 critical splice acceptor site probably null
R0847:Abcb1b UTSW 5 8845764 missense probably damaging 0.99
R1037:Abcb1b UTSW 5 8825657 missense probably benign 0.03
R1432:Abcb1b UTSW 5 8837771 missense possibly damaging 0.69
R1437:Abcb1b UTSW 5 8821436 missense possibly damaging 0.90
R1520:Abcb1b UTSW 5 8814768 missense probably damaging 1.00
R1686:Abcb1b UTSW 5 8798782 missense probably damaging 0.97
R1700:Abcb1b UTSW 5 8849537 missense probably benign 0.44
R1973:Abcb1b UTSW 5 8812746 missense probably benign 0.01
R1993:Abcb1b UTSW 5 8821322 missense possibly damaging 0.61
R2157:Abcb1b UTSW 5 8824791 missense probably benign 0.37
R2207:Abcb1b UTSW 5 8824803 missense probably benign 0.23
R2968:Abcb1b UTSW 5 8861485 missense probably damaging 1.00
R3858:Abcb1b UTSW 5 8813581 missense probably benign 0.11
R4223:Abcb1b UTSW 5 8813722 missense probably damaging 0.97
R4379:Abcb1b UTSW 5 8865875 missense probably benign 0.00
R4674:Abcb1b UTSW 5 8810615 missense probably benign
R4964:Abcb1b UTSW 5 8812671 missense probably benign 0.00
R4964:Abcb1b UTSW 5 8861602 missense probably damaging 1.00
R5167:Abcb1b UTSW 5 8812656 missense probably damaging 0.98
R5328:Abcb1b UTSW 5 8837694 missense possibly damaging 0.69
R5391:Abcb1b UTSW 5 8805481 missense probably null 0.00
R5399:Abcb1b UTSW 5 8827410 missense probably benign
R6047:Abcb1b UTSW 5 8806066 missense probably damaging 1.00
R6157:Abcb1b UTSW 5 8824245 missense possibly damaging 0.81
R6293:Abcb1b UTSW 5 8853493 missense probably benign 0.05
R6493:Abcb1b UTSW 5 8824698 missense probably damaging 1.00
R6593:Abcb1b UTSW 5 8853491 missense probably benign
R6799:Abcb1b UTSW 5 8812656 missense probably damaging 0.98
R6944:Abcb1b UTSW 5 8813693 missense probably damaging 1.00
R7028:Abcb1b UTSW 5 8805441 missense probably damaging 0.99
R7227:Abcb1b UTSW 5 8825593 missense probably damaging 1.00
R7495:Abcb1b UTSW 5 8865871 missense probably damaging 1.00
R7573:Abcb1b UTSW 5 8828866 missense possibly damaging 0.80
R7681:Abcb1b UTSW 5 8849619 missense probably benign 0.00
R7827:Abcb1b UTSW 5 8837747 missense probably damaging 0.96
R7860:Abcb1b UTSW 5 8832258 missense probably benign 0.12
R7943:Abcb1b UTSW 5 8832258 missense probably benign 0.12
R8009:Abcb1b UTSW 5 8828870 missense possibly damaging 0.65
R8054:Abcb1b UTSW 5 8824272 missense probably benign
X0025:Abcb1b UTSW 5 8824515 missense possibly damaging 0.91
X0061:Abcb1b UTSW 5 8864269 splice site probably null
Z1176:Abcb1b UTSW 5 8827441 missense probably benign
Z1177:Abcb1b UTSW 5 8837596 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCTGGAAACAATCTGTCATG -3'
(R):5'- AGTGGGGCAGAGTCATCCTATC -3'

Sequencing Primer
(F):5'- AATTTATGTCAGACTCAGTGATGC -3'
(R):5'- TATCCCACTTATTGGCAAACAGAAG -3'
Posted On2016-07-22