Mutagenetix > Incidental Mutations

Incidental Mutation 'R5279:Mrc1'

404082

Institutional Source

Beutler Lab

Gene Symbol

Mrc1

Ensembl Gene

ENSMUSG00000026712

Gene Name

mannose receptor, C type 1

Synonyms

CD206, MR

MMRRC Submission

042839-MU

Accession Numbers

Ncbi RefSeq: NM_008625.2; MGI:97142

Is this an essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R5279 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14229392-14332057 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 14310058 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 985 (S985P)

Ref Sequence

ENSEMBL: ENSMUSP00000028045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028045]

PDB Structure

CRYSTAL STRUCTURE OF THE CYSTEINE RICH DOMAIN OF MANNOSE RECEPTOR [X-RAY DIFFRACTION]
Crystal structure of the cysteine rich domain of mannose receptor complexed with Acetylgalactosamine-4-sulfate [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(X) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(A) [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028045
AA Change: S985P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000028045
Gene: ENSMUSG00000026712
AA Change: S985P

Domain	Start	End	E-Value	Type
RICIN	22	142	8.09e-18	SMART
FN2	161	209	1.83e-27	SMART
CLECT	216	341	8.87e-26	SMART
CLECT	362	487	3.51e-38	SMART
CLECT	504	626	8.2e-30	SMART
CLECT	646	778	2.34e-34	SMART
CLECT	800	923	2.17e-29	SMART
low complexity region	935	941	N/A	INTRINSIC
CLECT	944	1079	3.35e-35	SMART
CLECT	1094	1212	4.11e-21	SMART
CLECT	1229	1355	3.63e-31	SMART
transmembrane domain	1388	1410	N/A	INTRINSIC

Meta Mutation Damage Score

0.4040

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

99% (73/74)

MGI Phenotype

Strain: 2656742; 2448258
Lethality: E1-E7
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]
PHENOTYPE: Male homozygotes for one targeted null mutation die in utero. Heterozygous females clear lutropin from the circulation more slowly and have smaller litters due to reduced implantation. Another targeted knockout is viable and homozygotes are less susceptible to parasitic infection. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	C	A	17: 24,289,414	G1049V	probably damaging	Het
Afdn	G	A	17: 13,888,952	R1579H	probably damaging	Het
Ankrd28	T	A	14: 31,735,006	N386Y	probably damaging	Het
Atf7ip	T	A	6: 136,603,379	Y1100*	probably null	Het
Atp9b	T	A	18: 80,912,858	E3V	probably damaging	Het
AW554918	T	G	18: 25,175,431	D60E	possibly damaging	Het
Baz2b	G	T	2: 59,932,152	Q927K	probably damaging	Het
Birc6	A	G	17: 74,650,047	R3659G	probably damaging	Het
C8a	T	G	4: 104,845,988	N291H	probably damaging	Het
Calcoco1	G	A	15: 102,710,985	L390F	probably damaging	Het
Carmil3	A	G	14: 55,501,571	D894G	probably damaging	Het
Cdc20	A	G	4: 118,433,514	Y430H	probably damaging	Het
Cdc6	A	T	11: 98,912,262	I316F	probably damaging	Het
Cenpu	T	A	8: 46,578,910		probably null	Het
Csmd2	T	A	4: 128,456,914	V1592D	probably benign	Het
Csmd3	G	T	15: 48,791,944		probably null	Het
Dnah7c	T	C	1: 46,519,269	F512L	probably benign	Het
Fam136a	T	A	6: 86,366,704	L61Q	probably damaging	Het
Fpgs	A	C	2: 32,692,767		probably benign	Het
Fzd4	G	A	7: 89,407,673	M309I	probably benign	Het
Gad2	A	G	2: 22,673,957	T391A	probably benign	Het
Gm11563	A	T	11: 99,658,713	S72T	unknown	Het
Gm5155	T	A	7: 17,873,289		noncoding transcript	Het
Gon4l	A	G	3: 88,887,637	I716V	probably benign	Het
Itga9	T	C	9: 118,628,205	V128A	probably damaging	Het
Kat6a	CGCAGCAGCAGCAGCAGCA	CGCAGCAGCAGCA	8: 22,939,648		probably benign	Het
Lrrc9	T	A	12: 72,495,594	D1063E	possibly damaging	Het
Lyst	T	A	13: 13,648,802	L1453*	probably null	Het
Mcm3ap	T	C	10: 76,507,539	V1755A	probably damaging	Het
Mst1	A	C	9: 108,082,215	K233N	probably damaging	Het
Nr2c2ap	G	A	8: 70,132,003	D42N	probably damaging	Het
Ntn1	A	G	11: 68,385,712	S137P	probably benign	Het
Pard3	T	C	8: 127,460,386		probably null	Het
Pcdh15	T	A	10: 74,594,183	D1210E	probably damaging	Het
Pcdhga5	T	C	18: 37,694,721	L74P	probably benign	Het
Pcsk5	T	C	19: 17,595,658		probably null	Het
Pdia3	T	C	2: 121,414,003		probably benign	Het
Pikfyve	A	T	1: 65,196,699	R177*	probably null	Het
Pklr	A	G	3: 89,143,259	E409G	probably damaging	Het
Plod2	T	C	9: 92,581,323	Y154H	probably damaging	Het
Psmc3	T	A	2: 91,054,322	D6E	probably benign	Het
Ptpru	T	A	4: 131,820,023	N205I	possibly damaging	Het
Rbm6	T	C	9: 107,778,014	E1006G	probably benign	Het
Rgl2	T	C	17: 33,935,948	V642A	probably benign	Het
Rnf8	T	A	17: 29,626,706	H104Q	possibly damaging	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Rpa1	T	C	11: 75,313,344	N269S	probably damaging	Het
Sdk2	A	G	11: 113,867,031	M519T	probably benign	Het
Snx30	A	G	4: 59,885,070	S237G	probably benign	Het
Spx	A	G	6: 142,414,040	N36S	probably damaging	Het
Stard7	T	C	2: 127,295,496	Y289H	probably damaging	Het
Sugp2	T	C	8: 70,257,107		probably benign	Het
Susd4	C	T	1: 182,887,478	T288I	probably damaging	Het
Tceanc2	T	A	4: 107,177,629		probably null	Het
Tm4sf4	T	G	3: 57,433,738	V97G	probably benign	Het
Tmtc1	C	T	6: 148,355,131		probably benign	Het
Trappc11	C	T	8: 47,505,304		probably benign	Het
Triobp	G	T	15: 78,994,391	V398F	possibly damaging	Het
Ttll9	T	A	2: 152,962,544	S2T	possibly damaging	Het
Ttn	T	C	2: 76,900,976		probably benign	Het
Tyw3	A	G	3: 154,594,471	C80R	probably damaging	Het
Usp24	T	C	4: 106,385,424	V1177A	possibly damaging	Het
Vmn1r65	A	G	7: 6,008,755	V160A	probably damaging	Het
Vmn2r104	T	A	17: 20,041,884	H328L	probably benign	Het
Vmn2r65	A	C	7: 84,940,641	I689S	probably damaging	Het
Wrn	A	G	8: 33,241,101	Y1068H	probably damaging	Het
Xpo4	C	A	14: 57,613,409	S346I	probably benign	Het
Zc3h3	T	A	15: 75,839,590	T341S	probably benign	Het
Zxdc	T	C	6: 90,370,437	M260T	possibly damaging	Het

Other mutations in Mrc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:Mrc1	APN	2	14328425	missense	probably damaging	1.00
IGL01326:Mrc1	APN	2	14266524	missense	probably damaging	1.00
IGL01340:Mrc1	APN	2	14310084	critical splice donor site	probably null
IGL01758:Mrc1	APN	2	14238248	missense	probably damaging	1.00
IGL01799:Mrc1	APN	2	14238376	missense	probably damaging	1.00
IGL02280:Mrc1	APN	2	14244213	missense	probably benign	0.19
IGL02435:Mrc1	APN	2	14248860	nonsense	probably null
IGL03073:Mrc1	APN	2	14305342	missense	probably damaging	1.00
IGL03110:Mrc1	APN	2	14293478	nonsense	probably null
IGL03155:Mrc1	APN	2	14331101	missense	probably benign	0.00
IGL03289:Mrc1	APN	2	14308823	critical splice donor site	probably null
amlodipine	UTSW	2	14270205	missense	probably damaging	1.00
losartan	UTSW	2	14294786	splice site	probably null
Shug	UTSW	2	14270206	missense	probably damaging	1.00
sussigkeit	UTSW	2	14325381	splice site	probably null
R0011:Mrc1	UTSW	2	14261337	critical splice donor site	probably null
R0011:Mrc1	UTSW	2	14261337	critical splice donor site	probably null
R0066:Mrc1	UTSW	2	14261200	missense	probably benign	0.42
R0066:Mrc1	UTSW	2	14261200	missense	probably benign	0.42
R0110:Mrc1	UTSW	2	14238542	splice site	probably benign
R0234:Mrc1	UTSW	2	14279894	missense	possibly damaging	0.65
R0234:Mrc1	UTSW	2	14279894	missense	possibly damaging	0.65
R0381:Mrc1	UTSW	2	14307909	missense	probably benign	0.05
R0505:Mrc1	UTSW	2	14310032	missense	probably damaging	1.00
R0539:Mrc1	UTSW	2	14270126	splice site	probably benign
R0613:Mrc1	UTSW	2	14294819	missense	probably damaging	0.96
R0626:Mrc1	UTSW	2	14328571	nonsense	probably null
R1122:Mrc1	UTSW	2	14261336	critical splice donor site	probably null
R1281:Mrc1	UTSW	2	14293510	missense	probably damaging	1.00
R1399:Mrc1	UTSW	2	14279925	missense	probably damaging	1.00
R1428:Mrc1	UTSW	2	14315263	missense	probably benign	0.11
R1571:Mrc1	UTSW	2	14308733	missense	probably damaging	0.97
R1596:Mrc1	UTSW	2	14248890	missense	possibly damaging	0.91
R1730:Mrc1	UTSW	2	14327844	missense	probably benign	0.01
R1733:Mrc1	UTSW	2	14257099	missense	probably damaging	1.00
R1783:Mrc1	UTSW	2	14327844	missense	probably benign	0.01
R1860:Mrc1	UTSW	2	14328579	missense	probably benign	0.30
R1872:Mrc1	UTSW	2	14325381	splice site	probably null
R1889:Mrc1	UTSW	2	14308677	critical splice acceptor site	probably null
R1938:Mrc1	UTSW	2	14319241	missense	possibly damaging	0.89
R1971:Mrc1	UTSW	2	14244292	critical splice donor site	probably null
R2031:Mrc1	UTSW	2	14321773	missense	probably damaging	1.00
R2136:Mrc1	UTSW	2	14270189	missense	probably damaging	1.00
R2152:Mrc1	UTSW	2	14327864	missense	probably damaging	1.00
R2168:Mrc1	UTSW	2	14244204	missense	possibly damaging	0.90
R2273:Mrc1	UTSW	2	14325372	missense	probably damaging	1.00
R2901:Mrc1	UTSW	2	14328543	missense	possibly damaging	0.94
R3767:Mrc1	UTSW	2	14319170	missense	probably damaging	1.00
R3795:Mrc1	UTSW	2	14288982	splice site	probably benign
R4028:Mrc1	UTSW	2	14238248	missense	probably damaging	1.00
R4668:Mrc1	UTSW	2	14293486	missense	probably damaging	1.00
R4828:Mrc1	UTSW	2	14270206	missense	probably damaging	1.00
R4897:Mrc1	UTSW	2	14319141	missense	probably benign	0.01
R4950:Mrc1	UTSW	2	14271280	missense	probably damaging	1.00
R5000:Mrc1	UTSW	2	14244189	missense	probably damaging	1.00
R5068:Mrc1	UTSW	2	14306516	missense	probably benign	0.00
R5366:Mrc1	UTSW	2	14321914	missense	probably benign	0.03
R5436:Mrc1	UTSW	2	14266515	missense	probably damaging	1.00
R5552:Mrc1	UTSW	2	14279957	missense	probably benign	0.05
R5631:Mrc1	UTSW	2	14328572	nonsense	probably null
R5831:Mrc1	UTSW	2	14308712	missense	probably damaging	0.99
R5978:Mrc1	UTSW	2	14315393	missense	probably damaging	0.97
R5993:Mrc1	UTSW	2	14305327	missense	probably damaging	1.00
R6030:Mrc1	UTSW	2	14316901	missense	probably benign	0.04
R6030:Mrc1	UTSW	2	14316901	missense	probably benign	0.04
R6038:Mrc1	UTSW	2	14257071	missense	probably damaging	1.00
R6038:Mrc1	UTSW	2	14257071	missense	probably damaging	1.00
R6228:Mrc1	UTSW	2	14271304	missense	probably benign	0.08
R6344:Mrc1	UTSW	2	14244174	missense	probably damaging	1.00
R6457:Mrc1	UTSW	2	14270205	missense	probably damaging	1.00
R6520:Mrc1	UTSW	2	14307949	missense	probably damaging	1.00
R6619:Mrc1	UTSW	2	14294786	splice site	probably null
R6631:Mrc1	UTSW	2	14238485	missense	probably benign
R6737:Mrc1	UTSW	2	14271277	missense	possibly damaging	0.95
R6782:Mrc1	UTSW	2	14261337	critical splice donor site	probably null
R6887:Mrc1	UTSW	2	14325237	missense	possibly damaging	0.94
R7108:Mrc1	UTSW	2	14304146	nonsense	probably null
R7120:Mrc1	UTSW	2	14308697	missense	probably damaging	0.97
R7460:Mrc1	UTSW	2	14248869	missense	probably damaging	1.00
R7567:Mrc1	UTSW	2	14325293	missense	probably damaging	1.00
R7606:Mrc1	UTSW	2	14238144	missense	probably damaging	1.00
R7725:Mrc1	UTSW	2	14279977	missense	probably benign	0.03
R7826:Mrc1	UTSW	2	14294857	missense	probably damaging	1.00
R8082:Mrc1	UTSW	2	14248960	missense	probably benign
R8279:Mrc1	UTSW	2	14266357	missense	possibly damaging	0.89
Z1177:Mrc1	UTSW	2	14244138	missense	probably damaging	1.00
Z1177:Mrc1	UTSW	2	14289116	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAATTCTCCTTTAGGCCTGAG -3'
(R):5'- AAGTGTCATTTCTCTGTCCATATGC -3'

Sequencing Primer
(F):5'- AAAACCTCTGCTTTTGTCC -3'
(R):5'- CCCAGTATATCTAGCATCAATGGGAG -3'

Posted On

2016-07-22