Incidental Mutation 'R5303:Gria1'
ID404363
Institutional Source Beutler Lab
Gene Symbol Gria1
Ensembl Gene ENSMUSG00000020524
Gene Nameglutamate receptor, ionotropic, AMPA1 (alpha 1)
SynonymsGlr1, Glur-1, GluRA, HIPA1, GluR1, GluR-A, 2900051M01Rik, Glur1, GluA1, Glr-1
MMRRC Submission 042886-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5303 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location57011387-57330244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57243025 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 577 (T577A)
Ref Sequence ENSEMBL: ENSMUSP00000091731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036315] [ENSMUST00000094179] [ENSMUST00000151045]
Predicted Effect probably benign
Transcript: ENSMUST00000036315
AA Change: T577A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000044494
Gene: ENSMUSG00000020524
AA Change: T577A

DomainStartEndE-ValueType
Pfam:ANF_receptor 37 372 9.3e-63 PFAM
PBPe 408 783 3.65e-121 SMART
Lig_chan-Glu_bd 418 483 1.65e-29 SMART
low complexity region 863 874 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094179
AA Change: T577A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000091731
Gene: ENSMUSG00000020524
AA Change: T577A

DomainStartEndE-ValueType
Pfam:ANF_receptor 37 372 3.7e-69 PFAM
PBPe 408 783 2.09e-121 SMART
Lig_chan-Glu_bd 418 483 1.65e-29 SMART
low complexity region 863 874 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151045
AA Change: T508A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000117746
Gene: ENSMUSG00000020524
AA Change: T508A

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 303 4.7e-58 PFAM
PBPe 339 714 3.65e-121 SMART
Lig_chan-Glu_bd 349 414 1.65e-29 SMART
transmembrane domain 739 761 N/A INTRINSIC
low complexity region 794 805 N/A INTRINSIC
Meta Mutation Damage Score 0.0854 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes with multiple subunits, each possessing transmembrane regions, and all arranged to form a ligand-gated ion channel. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. This gene belongs to a family of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) receptors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with mutations in phosphorylation sites have LTD and LTP deficits and spatial learning memory defects. Null homozygotes also show stimulus-reward learning deficits and increases locomotor activity and context-dependent sensitization to amphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik A G 2: 19,516,299 Y256H possibly damaging Het
Abcc12 C A 8: 86,509,786 R1133L probably benign Het
Acss3 T A 10: 107,084,851 T133S possibly damaging Het
Adra1d G A 2: 131,546,249 P462L possibly damaging Het
Ank2 A T 3: 126,945,804 probably benign Het
Arid2 G A 15: 96,392,468 R1748Q probably damaging Het
B3glct C T 5: 149,754,023 probably benign Het
C3ar1 A T 6: 122,849,835 S474R probably damaging Het
Cd1d1 A G 3: 86,998,120 F189L probably benign Het
Cd46 T C 1: 195,062,399 I344V probably benign Het
Chrna1 T C 2: 73,566,274 M426V probably benign Het
Cinp G A 12: 110,876,861 T139M probably damaging Het
Disp2 T C 2: 118,810,848 probably benign Het
Eapp G A 12: 54,692,918 P38L probably damaging Het
Eif4g3 T C 4: 138,126,562 S480P probably benign Het
Epb41l3 G C 17: 69,257,449 E390Q probably damaging Het
Fermt1 T C 2: 132,911,339 probably null Het
Foxf2 T A 13: 31,626,480 F134Y possibly damaging Het
Foxp2 T A 6: 15,324,637 C95S probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hal A G 10: 93,516,365 probably benign Het
Hdac7 C A 15: 97,798,018 E670D probably damaging Het
Islr2 A T 9: 58,208,275 probably benign Het
Itpr3 T C 17: 27,116,689 Y2258H probably benign Het
Mical3 G T 6: 120,959,980 T1195K probably benign Het
Myh1 T C 11: 67,202,017 S46P probably benign Het
Mylk3 T A 8: 85,350,476 I444F probably damaging Het
Nlrc3 A T 16: 3,963,614 C644S probably benign Het
Notch1 C T 2: 26,478,619 V553M probably benign Het
Olfr1245 T A 2: 89,575,001 I242F possibly damaging Het
Olfr1454 T A 19: 13,063,775 Y121* probably null Het
Olfr644 T C 7: 104,069,032 probably benign Het
Olfr979 A G 9: 40,000,588 I213T probably damaging Het
Pih1d3 G A 1: 31,223,456 R173H probably damaging Het
Postn A G 3: 54,377,597 T669A probably damaging Het
Ppp5c G T 7: 17,005,284 Q472K probably benign Het
Qsox1 T C 1: 155,779,293 H708R probably benign Het
Rhbdl2 A G 4: 123,810,221 probably benign Het
Ryr1 C T 7: 29,068,482 E2884K probably damaging Het
Saysd1 T C 14: 20,082,958 T44A probably benign Het
Sept14 T A 5: 129,689,648 M290L possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc38a8 C A 8: 119,486,041 V294L possibly damaging Het
Spdye4b C T 5: 143,202,403 T217I probably benign Het
Sugp2 T A 8: 70,242,177 probably benign Het
Syne1 T C 10: 5,420,464 T232A probably benign Het
Tbc1d5 A T 17: 50,736,200 D753E probably benign Het
Tmed1 G T 9: 21,510,047 Q44K possibly damaging Het
Ttc6 T A 12: 57,575,820 S2T possibly damaging Het
Ube4b T C 4: 149,383,803 D172G probably damaging Het
Vmn1r235 C A 17: 21,262,006 Q198K probably benign Het
Wdfy3 T C 5: 101,952,983 H256R probably damaging Het
Zfat A T 15: 68,110,486 H1059Q probably damaging Het
Zfp758 A G 17: 22,374,861 I77M probably benign Het
Zfp850 C T 7: 28,008,413 A2T probably damaging Het
Zfyve1 A T 12: 83,575,056 N188K probably damaging Het
Zyg11a C T 4: 108,184,432 probably null Het
Other mutations in Gria1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Gria1 APN 11 57242941 nonsense probably null
IGL00807:Gria1 APN 11 57012040 missense probably benign
IGL00816:Gria1 APN 11 57317742 missense possibly damaging 0.93
IGL01110:Gria1 APN 11 57289381 missense probably damaging 1.00
IGL01116:Gria1 APN 11 57236975 missense probably damaging 1.00
IGL01120:Gria1 APN 11 57317669 missense probably damaging 0.99
IGL01843:Gria1 APN 11 57317774 missense probably damaging 1.00
IGL02135:Gria1 APN 11 57185853 missense probably damaging 1.00
IGL02308:Gria1 APN 11 57236924 missense probably benign 0.00
IGL02554:Gria1 APN 11 57289488 missense possibly damaging 0.72
IGL02813:Gria1 APN 11 57283584 missense probably damaging 1.00
IGL03071:Gria1 APN 11 57012110 unclassified probably null
IGL03326:Gria1 APN 11 57317773 missense probably damaging 1.00
PIT4445001:Gria1 UTSW 11 57185838 missense probably damaging 1.00
R0087:Gria1 UTSW 11 57317712 missense probably damaging 1.00
R0387:Gria1 UTSW 11 57309884 critical splice donor site probably null
R0399:Gria1 UTSW 11 57186027 missense probably damaging 0.97
R0502:Gria1 UTSW 11 57189716 missense probably damaging 1.00
R0503:Gria1 UTSW 11 57189716 missense probably damaging 1.00
R0549:Gria1 UTSW 11 57228973 missense probably damaging 1.00
R0590:Gria1 UTSW 11 57289409 missense probably damaging 1.00
R1377:Gria1 UTSW 11 57201176 missense probably damaging 1.00
R1395:Gria1 UTSW 11 57283566 missense probably damaging 1.00
R1422:Gria1 UTSW 11 57189788 missense probably benign 0.00
R1581:Gria1 UTSW 11 57237010 splice site probably null
R2002:Gria1 UTSW 11 57012104 missense possibly damaging 0.93
R2064:Gria1 UTSW 11 57317708 missense probably damaging 0.98
R2255:Gria1 UTSW 11 57185949 missense probably damaging 1.00
R2507:Gria1 UTSW 11 57289320 missense probably null 0.30
R2965:Gria1 UTSW 11 57185801 nonsense probably null
R3012:Gria1 UTSW 11 57289434 missense probably damaging 1.00
R3151:Gria1 UTSW 11 57283562 missense probably damaging 1.00
R3807:Gria1 UTSW 11 57310678 missense probably damaging 1.00
R5026:Gria1 UTSW 11 57310696 missense probably damaging 1.00
R5132:Gria1 UTSW 11 57289399 missense probably damaging 1.00
R5222:Gria1 UTSW 11 57189797 missense probably benign 0.22
R5332:Gria1 UTSW 11 57327621 missense possibly damaging 0.93
R5413:Gria1 UTSW 11 57217794 missense probably benign 0.00
R5748:Gria1 UTSW 11 57309876 missense probably benign 0.00
R5878:Gria1 UTSW 11 57317802 critical splice donor site probably null
R5937:Gria1 UTSW 11 57189733 missense probably benign 0.00
R5995:Gria1 UTSW 11 57289285 missense probably damaging 1.00
R6031:Gria1 UTSW 11 57217782 missense probably damaging 1.00
R6031:Gria1 UTSW 11 57217782 missense probably damaging 1.00
R6180:Gria1 UTSW 11 57242792 missense probably damaging 1.00
R6187:Gria1 UTSW 11 57238110 missense possibly damaging 0.84
R6262:Gria1 UTSW 11 57242854 missense probably damaging 1.00
R6828:Gria1 UTSW 11 57289462 missense probably damaging 1.00
R7374:Gria1 UTSW 11 57189808 missense probably benign
R7507:Gria1 UTSW 11 57228939 missense probably benign 0.14
R7511:Gria1 UTSW 11 57283625 missense probably damaging 1.00
R7691:Gria1 UTSW 11 57236987 missense possibly damaging 0.94
R7898:Gria1 UTSW 11 57242765 missense probably damaging 1.00
R7981:Gria1 UTSW 11 57242765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAAGTCCAAGCCAGGTG -3'
(R):5'- ATATTACCCAGGCAGCAGACAG -3'

Sequencing Primer
(F):5'- AGAAGTCCAAGCCAGGTGTCTTC -3'
(R):5'- CCTGGGATTACAAGCGGATACTATC -3'
Posted On2016-07-22