Incidental Mutation 'R5404:Slc40a1'
ID428612
Institutional Source Beutler Lab
Gene Symbol Slc40a1
Ensembl Gene ENSMUSG00000025993
Gene Namesolute carrier family 40 (iron-regulated transporter), member 1
SynonymsDusg, metal transporting protein 1, Ol5, ferroportin1, IREG1, Slc11a3, FPN1, Pcm, MTP1
MMRRC Submission 042975-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5404 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location45908068-45926523 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45912328 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 223 (L223P)
Ref Sequence ENSEMBL: ENSMUSP00000027137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027137]
Predicted Effect probably damaging
Transcript: ENSMUST00000027137
AA Change: L223P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027137
Gene: ENSMUSG00000025993
AA Change: L223P

DomainStartEndE-ValueType
Pfam:FPN1 22 530 5e-194 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191247
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell membrane protein that may be involved in iron export from duodenal epithelial cells. Defects in this gene are a cause of hemochromatosis type 4 (HFE4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit embryonic lethality before embryo turning. Mice heterozygous for a targeted mutation display decreased thermal response latency. Mice heterozygous for an ENU induced mutation display abnormal iron homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,696 H297R probably benign Het
Ccnk A T 12: 108,195,623 K262N possibly damaging Het
Clec4b2 A T 6: 123,181,349 Y58F probably benign Het
Cp A C 3: 19,989,128 T1027P possibly damaging Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Cry1 T C 10: 85,184,419 N18S probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock10 A G 1: 80,503,913 probably benign Het
Fance A T 17: 28,318,060 R58W probably null Het
Fermt1 T C 2: 132,934,869 D233G possibly damaging Het
Gabpa T A 16: 84,860,463 Y409N probably damaging Het
Gpr162 A G 6: 124,861,643 S15P possibly damaging Het
Grid2 T A 6: 63,930,910 I178N probably damaging Het
Il17re T C 6: 113,469,102 V233A probably benign Het
Lemd3 G A 10: 120,931,958 Q672* probably null Het
Myh15 A G 16: 49,159,978 T1488A probably benign Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Nedd1 C T 10: 92,716,192 V69I probably benign Het
Nfil3 G A 13: 52,968,055 S271F probably damaging Het
Npc1 A G 18: 12,213,299 L280P possibly damaging Het
Olfr1181 C T 2: 88,423,801 V75M probably damaging Het
Olfr138 T A 17: 38,275,626 L285* probably null Het
Olfr559 T A 7: 102,723,600 I297F possibly damaging Het
Poli A G 18: 70,509,432 S503P probably benign Het
Rbm5 T C 9: 107,765,553 E94G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rps6ka5 T C 12: 100,616,093 I173M probably damaging Het
Smg1 T C 7: 118,206,908 K213E probably damaging Het
Spem1 T A 11: 69,820,937 K300N probably damaging Het
Tchh A G 3: 93,447,675 E1474G unknown Het
Tenm4 A T 7: 96,894,680 R1968W probably damaging Het
Tshz2 A T 2: 169,884,320 M279L probably benign Het
Tuba3a G T 6: 125,281,592 T145K possibly damaging Het
Other mutations in Slc40a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Slc40a1 APN 1 45909492 missense probably benign 0.19
IGL01576:Slc40a1 APN 1 45909597 missense probably damaging 1.00
IGL02113:Slc40a1 APN 1 45910894 missense probably benign 0.33
IGL02116:Slc40a1 APN 1 45911528 missense probably benign 0.01
IGL02220:Slc40a1 APN 1 45911335 missense probably damaging 1.00
IGL02537:Slc40a1 APN 1 45911393 missense probably benign 0.01
IGL02574:Slc40a1 APN 1 45912374 missense possibly damaging 0.77
IGL02673:Slc40a1 APN 1 45918416 missense possibly damaging 0.82
IGL02794:Slc40a1 APN 1 45909508 nonsense probably null
R0376:Slc40a1 UTSW 1 45912491 splice site probably benign
R0417:Slc40a1 UTSW 1 45911374 missense possibly damaging 0.50
R1608:Slc40a1 UTSW 1 45911297 missense probably damaging 0.96
R1723:Slc40a1 UTSW 1 45924761 missense probably damaging 1.00
R1892:Slc40a1 UTSW 1 45911142 nonsense probably null
R2092:Slc40a1 UTSW 1 45909454 missense probably benign
R2303:Slc40a1 UTSW 1 45910884 splice site probably benign
R2365:Slc40a1 UTSW 1 45924713 splice site probably null
R3718:Slc40a1 UTSW 1 45910991 missense probably benign
R4689:Slc40a1 UTSW 1 45912313 missense probably benign 0.00
R4994:Slc40a1 UTSW 1 45909664 missense probably damaging 1.00
R5103:Slc40a1 UTSW 1 45918995 nonsense probably null
R5151:Slc40a1 UTSW 1 45911356 missense possibly damaging 0.84
R5364:Slc40a1 UTSW 1 45925223 missense probably damaging 0.96
R5531:Slc40a1 UTSW 1 45912338 missense probably damaging 1.00
R5841:Slc40a1 UTSW 1 45912349 missense probably damaging 1.00
R6440:Slc40a1 UTSW 1 45925262 start codon destroyed probably null 0.94
R6455:Slc40a1 UTSW 1 45918947 missense probably damaging 0.99
R6975:Slc40a1 UTSW 1 45909492 missense probably benign 0.19
R7085:Slc40a1 UTSW 1 45911528 missense probably benign
R7130:Slc40a1 UTSW 1 45921224 missense probably damaging 1.00
R7502:Slc40a1 UTSW 1 45918974 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCACAGTTCTTTCCAGAATCTG -3'
(R):5'- CTTGCACCTACCTGTGTAGAC -3'

Sequencing Primer
(F):5'- TCTAGGCTTTCCCTGGAAACACAG -3'
(R):5'- GCACCTACCTGTGTAGACATGAATG -3'
Posted On2016-09-06