Incidental Mutation 'R3718:Slc40a1'
ID258771
Institutional Source Beutler Lab
Gene Symbol Slc40a1
Ensembl Gene ENSMUSG00000025993
Gene Namesolute carrier family 40 (iron-regulated transporter), member 1
SynonymsDusg, metal transporting protein 1, Ol5, ferroportin1, IREG1, Slc11a3, FPN1, Pcm, MTP1
MMRRC Submission 040710-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3718 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location45908068-45926523 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 45910991 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 434 (H434N)
Ref Sequence ENSEMBL: ENSMUSP00000027137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027137]
Predicted Effect probably benign
Transcript: ENSMUST00000027137
AA Change: H434N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027137
Gene: ENSMUSG00000025993
AA Change: H434N

DomainStartEndE-ValueType
Pfam:FPN1 22 530 5e-194 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191247
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell membrane protein that may be involved in iron export from duodenal epithelial cells. Defects in this gene are a cause of hemochromatosis type 4 (HFE4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit embryonic lethality before embryo turning. Mice heterozygous for a targeted mutation display decreased thermal response latency. Mice heterozygous for an ENU induced mutation display abnormal iron homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T C 15: 41,866,293 D237G probably benign Het
Alas2 T C X: 150,560,730 probably benign Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Aspm T C 1: 139,480,889 Y2505H probably benign Het
Aspm G A 1: 139,490,427 V2965I probably benign Het
Ccna2 A T 3: 36,566,238 V285E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Dpp3 A G 19: 4,923,065 probably null Het
Gng11 G A 6: 4,008,078 R47H probably benign Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il18r1 A G 1: 40,495,788 E381G probably benign Het
Il9 G A 13: 56,479,451 T116I probably damaging Het
Kcnh1 A G 1: 192,238,799 T129A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Ntsr1 T C 2: 180,542,706 F401L probably benign Het
Nup210 A T 6: 91,020,180 D1626E probably benign Het
Olfr1277 A G 2: 111,270,226 V47A probably benign Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Olfr943 A G 9: 39,185,065 R293G probably damaging Het
Pign A G 1: 105,649,281 probably null Het
Rad54l2 A G 9: 106,693,527 V1198A probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Trdv2-1 T C 14: 53,946,538 Y76H probably benign Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Zc3hav1l G T 6: 38,295,125 S236R probably damaging Het
Other mutations in Slc40a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Slc40a1 APN 1 45909492 missense probably benign 0.19
IGL01576:Slc40a1 APN 1 45909597 missense probably damaging 1.00
IGL02113:Slc40a1 APN 1 45910894 missense probably benign 0.33
IGL02116:Slc40a1 APN 1 45911528 missense probably benign 0.01
IGL02220:Slc40a1 APN 1 45911335 missense probably damaging 1.00
IGL02537:Slc40a1 APN 1 45911393 missense probably benign 0.01
IGL02574:Slc40a1 APN 1 45912374 missense possibly damaging 0.77
IGL02673:Slc40a1 APN 1 45918416 missense possibly damaging 0.82
IGL02794:Slc40a1 APN 1 45909508 nonsense probably null
R0376:Slc40a1 UTSW 1 45912491 splice site probably benign
R0417:Slc40a1 UTSW 1 45911374 missense possibly damaging 0.50
R1608:Slc40a1 UTSW 1 45911297 missense probably damaging 0.96
R1723:Slc40a1 UTSW 1 45924761 missense probably damaging 1.00
R1892:Slc40a1 UTSW 1 45911142 nonsense probably null
R2092:Slc40a1 UTSW 1 45909454 missense probably benign
R2303:Slc40a1 UTSW 1 45910884 splice site probably benign
R2365:Slc40a1 UTSW 1 45924713 splice site probably null
R4689:Slc40a1 UTSW 1 45912313 missense probably benign 0.00
R4994:Slc40a1 UTSW 1 45909664 missense probably damaging 1.00
R5103:Slc40a1 UTSW 1 45918995 nonsense probably null
R5151:Slc40a1 UTSW 1 45911356 missense possibly damaging 0.84
R5364:Slc40a1 UTSW 1 45925223 missense probably damaging 0.96
R5404:Slc40a1 UTSW 1 45912328 missense probably damaging 1.00
R5531:Slc40a1 UTSW 1 45912338 missense probably damaging 1.00
R5841:Slc40a1 UTSW 1 45912349 missense probably damaging 1.00
R6440:Slc40a1 UTSW 1 45925262 start codon destroyed probably null 0.94
R6455:Slc40a1 UTSW 1 45918947 missense probably damaging 0.99
R6975:Slc40a1 UTSW 1 45909492 missense probably benign 0.19
R7085:Slc40a1 UTSW 1 45911528 missense probably benign
R7130:Slc40a1 UTSW 1 45921224 missense probably damaging 1.00
R7502:Slc40a1 UTSW 1 45918974 missense probably damaging 1.00
R7755:Slc40a1 UTSW 1 45911306 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGTTTTGCCTAAATTAACATCTG -3'
(R):5'- CTGGTCTATTCTCAGGACTAGCCC -3'

Sequencing Primer
(F):5'- CTTACCGATTCTAGCAGC -3'
(R):5'- AGGACTAGCCCAGCTTTCCTG -3'
Posted On2015-01-23