Incidental Mutation 'R5452:Hr'
ID432595
Institutional Source Beutler Lab
Gene Symbol Hr
Ensembl Gene ENSMUSG00000022096
Gene Namehairless
SynonymsALUNC, AU, N, ba, bldy, hr, rh, rh-bmh, rhino
MMRRC Submission 042848-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5452 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location70552212-70573548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 70556627 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 109 (G109V)
Ref Sequence ENSEMBL: ENSMUSP00000124042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022691] [ENSMUST00000161069] [ENSMUST00000163060]
Predicted Effect probably damaging
Transcript: ENSMUST00000022691
AA Change: G80V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022691
Gene: ENSMUSG00000022096
AA Change: G80V

DomainStartEndE-ValueType
Blast:JmjC 54 849 N/A BLAST
JmjC 939 1150 5.23e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159959
Predicted Effect probably damaging
Transcript: ENSMUST00000161069
AA Change: G80V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124816
Gene: ENSMUSG00000022096
AA Change: G80V

DomainStartEndE-ValueType
Blast:JmjC 54 849 N/A BLAST
JmjC 939 1150 5.23e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161468
Predicted Effect probably damaging
Transcript: ENSMUST00000163060
AA Change: G109V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124042
Gene: ENSMUSG00000022096
AA Change: G109V

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Blast:JmjC 83 878 N/A BLAST
JmjC 968 1179 5.23e-38 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in hair growth. This protein functions as a transcriptional corepressor of multiple nuclear receptors, including thyroid hormone receptor, the retinoic acid receptor-related orphan receptors and the vitamin D receptors, and it interacts with histone deacetylases. The translation of this protein is modulated by a regulatory ORF that exists upstream of the primary ORF. Mutations in this upstream ORF, U2HR, cause Marie Unna hereditary hypotrichosis (MUHH), an autosomal dominant form of genetic hair loss in human. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mutant homozygotes exhibit hair loss, usually wrinkled skin with epidermal cysts. Females do not nurse their pups well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C A 6: 149,329,113 S1219* probably null Het
Adam20 A T 8: 40,795,764 I304F probably damaging Het
Adamts5 A G 16: 85,869,912 probably null Het
Akr1c6 A G 13: 4,454,545 R132G probably benign Het
Ash1l T A 3: 88,984,876 M1354K possibly damaging Het
C6 T C 15: 4,814,829 I911T possibly damaging Het
Calm2 T C 17: 87,435,722 probably null Het
Ccdc80 G A 16: 45,118,165 R745Q probably damaging Het
Celsr3 T C 9: 108,844,034 I2685T possibly damaging Het
Chkb T C 15: 89,429,585 probably benign Het
Dennd5b T A 6: 149,041,513 probably null Het
Dnah2 T C 11: 69,524,383 Y175C probably damaging Het
Dnajc13 A G 9: 104,192,114 S1154P probably benign Het
Ephb4 T C 5: 137,361,142 S325P probably damaging Het
Fzd9 C T 5: 135,250,860 R57H probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm9949 A G 18: 62,180,516 probably benign Het
Gnb4 A T 3: 32,589,845 M188K probably benign Het
Lrp1b A G 2: 40,922,316 S2426P probably damaging Het
Map2k4 A G 11: 65,719,587 W88R probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Moxd2 C T 6: 40,882,114 probably null Het
Mrgprx1 T C 7: 48,021,808 I64V probably benign Het
Olfr493 A C 7: 108,346,105 I292S probably damaging Het
Padi2 T C 4: 140,932,071 F229S probably benign Het
Pappa2 T C 1: 158,838,602 N1136S probably benign Het
Pcdhb1 A T 18: 37,265,758 N254I possibly damaging Het
Plcb2 A G 2: 118,718,246 Y400H probably damaging Het
Plce1 A C 19: 38,620,482 T412P probably benign Het
Prg4 T C 1: 150,455,768 probably benign Het
Prkdc A G 16: 15,768,637 N2510S possibly damaging Het
Psme4 T A 11: 30,791,168 S107T probably benign Het
Rint1 G T 5: 23,794,365 A51S probably benign Het
Rsad1 T A 11: 94,543,689 R306S probably damaging Het
Sema3c T G 5: 17,717,070 probably null Het
Sirt3 G A 7: 140,865,015 T290I probably damaging Het
Skiv2l2 T C 13: 112,913,181 S232G probably null Het
Spam1 G A 6: 24,800,732 G490D probably benign Het
Speer4f2 C T 5: 17,376,500 R147W possibly damaging Het
Sppl2c A T 11: 104,187,300 I309L probably benign Het
Srxn1 G A 2: 152,105,879 V66M probably damaging Het
St3gal4 C T 9: 35,053,456 R152H probably damaging Het
Sv2c A T 13: 95,978,083 F532I probably damaging Het
Tacc1 C A 8: 25,164,415 K705N probably null Het
Tekt3 G T 11: 63,094,793 S475I probably damaging Het
Tjap1 T C 17: 46,260,175 T139A probably damaging Het
Tnfrsf8 T A 4: 145,292,644 K207M possibly damaging Het
Tnn T C 1: 160,110,261 T965A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trmt2a A G 16: 18,250,950 H270R probably damaging Het
Ttc21a T C 9: 119,950,971 L448P probably benign Het
Ttll4 C A 1: 74,679,321 N110K probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ubr1 A G 2: 120,868,302 Y1595H possibly damaging Het
Unc45a G A 7: 80,329,039 P621S probably damaging Het
Xrn2 A T 2: 147,024,713 probably null Het
Zcchc6 A G 13: 59,800,657 Y215H probably damaging Het
Other mutations in Hr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01805:Hr APN 14 70565297 splice site probably benign
IGL02020:Hr APN 14 70556437 missense probably benign 0.01
IGL02372:Hr APN 14 70558350 missense possibly damaging 0.94
IGL02380:Hr APN 14 70557761 missense probably damaging 0.98
IGL02554:Hr APN 14 70559866 splice site probably benign
IGL02949:Hr APN 14 70559785 missense possibly damaging 0.87
IGL03406:Hr APN 14 70563420 critical splice donor site probably null
angie UTSW 14 70567833 missense probably damaging 0.97
blofeld UTSW 14 70568085 missense probably damaging 1.00
general UTSW 14 70563684 critical splice donor site probably null
kaburo UTSW 14 unclassified
mister_clean UTSW 14 70560065 critical splice donor site probably benign
mushroom UTSW 14 70568085 missense probably damaging 1.00
prune UTSW 14 70571429 missense probably damaging 1.00
ren UTSW 14 70568085 missense probably damaging 1.00
subclinical UTSW 14 70561836 missense possibly damaging 0.89
yuanxiao UTSW 14 70571448 missense probably damaging 1.00
R0018:Hr UTSW 14 70558277 missense probably benign
R0038:Hr UTSW 14 70568085 missense probably damaging 1.00
R0374:Hr UTSW 14 70556476 missense probably benign 0.01
R0511:Hr UTSW 14 70561912 nonsense probably null
R0609:Hr UTSW 14 70559657 missense probably benign
R1828:Hr UTSW 14 70572037 critical splice donor site probably null
R2030:Hr UTSW 14 70571448 missense probably damaging 1.00
R2266:Hr UTSW 14 70558107 missense probably benign
R2267:Hr UTSW 14 70558107 missense probably benign
R2268:Hr UTSW 14 70558107 missense probably benign
R2377:Hr UTSW 14 70557878 missense probably damaging 1.00
R3686:Hr UTSW 14 70557796 missense probably damaging 0.98
R3687:Hr UTSW 14 70557796 missense probably damaging 0.98
R3754:Hr UTSW 14 70567824 missense probably damaging 1.00
R3803:Hr UTSW 14 70557893 missense probably benign 0.01
R3846:Hr UTSW 14 70571453 missense probably damaging 1.00
R3977:Hr UTSW 14 70563584 missense probably benign 0.01
R3978:Hr UTSW 14 70563584 missense probably benign 0.01
R3979:Hr UTSW 14 70563584 missense probably benign 0.01
R4528:Hr UTSW 14 70566383 missense probably damaging 1.00
R4654:Hr UTSW 14 70563573 missense probably damaging 0.99
R4834:Hr UTSW 14 70559922 missense probably damaging 0.98
R4847:Hr UTSW 14 70556476 missense probably benign 0.04
R4863:Hr UTSW 14 70571972 missense probably damaging 1.00
R5292:Hr UTSW 14 70571992 missense probably damaging 1.00
R5717:Hr UTSW 14 70566176 missense probably benign 0.34
R5902:Hr UTSW 14 70557791 missense probably benign 0.02
R6000:Hr UTSW 14 70567833 missense probably damaging 0.97
R6439:Hr UTSW 14 70561836 missense possibly damaging 0.89
R6823:Hr UTSW 14 70565374 missense probably damaging 0.98
R7030:Hr UTSW 14 70563684 critical splice donor site probably null
R7213:Hr UTSW 14 70558350 missense probably damaging 0.99
R7452:Hr UTSW 14 70571486 missense probably damaging 1.00
R7468:Hr UTSW 14 70558212 missense possibly damaging 0.89
R7572:Hr UTSW 14 70561853 missense possibly damaging 0.66
X0025:Hr UTSW 14 70566951 splice site probably null
X0026:Hr UTSW 14 70567841 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAACGGCATTGTGGGACAG -3'
(R):5'- GCTCTAGAATCTTGGTCTCCAGC -3'

Sequencing Primer
(F):5'- CATTGTGGGACAGGAGCC -3'
(R):5'- TCTTGGTCTCCAGCAGGAAAG -3'
Posted On2016-10-06