Mutagenetix > Incidental Mutation

Incidental Mutation 'R7452:Hr'

577824

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000022096

Gene Name

hairless

Synonyms

ALUNC, AU, N, ba, bldy, hr, rh, rh-bmh, rhino

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7452 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70552212-70573548 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70571486 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1101 (T1101A)

Ref Sequence

ENSEMBL: ENSMUSP00000124816 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022691] [ENSMUST00000161069] [ENSMUST00000163060]

AlphaFold

Q61645

Predicted Effect

probably damaging
Transcript: ENSMUST00000022691
AA Change: T1101A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022691
Gene: ENSMUSG00000022096
AA Change: T1101A

Domain	Start	End	E-Value	Type
Blast:JmjC	54	849	N/A	BLAST
JmjC	939	1150	5.23e-38	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000161069
AA Change: T1101A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124816
Gene: ENSMUSG00000022096
AA Change: T1101A

Domain	Start	End	E-Value	Type
Blast:JmjC	54	849	N/A	BLAST
JmjC	939	1150	5.23e-38	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163060
AA Change: T1130A

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000124042
Gene: ENSMUSG00000022096
AA Change: T1130A

Domain	Start	End	E-Value	Type
low complexity region	12	21	N/A	INTRINSIC
Blast:JmjC	83	878	N/A	BLAST
JmjC	968	1179	5.23e-38	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: This gene encodes a protein that is involved in hair growth. This protein functions as a transcriptional corepressor of multiple nuclear receptors, including thyroid hormone receptor, the retinoic acid receptor-related orphan receptors and the vitamin D receptors, and it interacts with histone deacetylases. The translation of this protein is modulated by a regulatory ORF that exists upstream of the primary ORF. Mutations in this upstream ORF, U2HR, cause Marie Unna hereditary hypotrichosis (MUHH), an autosomal dominant form of genetic hair loss in human. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mutant homozygotes exhibit hair loss, usually wrinkled skin with epidermal cysts. Females do not nurse their pups well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	G	7: 34,245,671	S595P	probably benign	Het
A2m	C	A	6: 121,641,332	Q195K	probably damaging	Het
Abcg4	C	T	9: 44,279,600	G249R	probably damaging	Het
Actn1	T	C	12: 80,183,602	T293A	probably benign	Het
Adamts5	T	A	16: 85,877,981	T432S	probably benign	Het
Adh5	A	G	3: 138,454,745	T347A	probably benign	Het
Agbl5	A	G	5: 30,893,391	D432G	probably damaging	Het
Ank3	A	G	10: 69,899,051	T797A	possibly damaging	Het
Aoc1	T	G	6: 48,908,790	V743G	probably benign	Het
Arap2	A	T	5: 62,676,549	S858R	probably benign	Het
Arid1a	A	C	4: 133,753,127	V162G	possibly damaging	Het
Armc9	A	G	1: 86,213,092	D588G	possibly damaging	Het
Art3	A	G	5: 92,392,680	Y94C	probably damaging	Het
Btaf1	T	A	19: 36,969,127	D444E	probably damaging	Het
Cav2	A	G	6: 17,282,076	H111R	probably damaging	Het
Ccdc148	A	G	2: 58,827,584	L469P	probably damaging	Het
Celsr2	T	A	3: 108,413,090	E802V	possibly damaging	Het
Cfap57	T	C	4: 118,595,784	D574G	probably damaging	Het
Chd7	A	C	4: 8,854,731	D2024A	probably benign	Het
Corin	T	A	5: 72,435,247	D269V	possibly damaging	Het
Cyp4a12a	A	T	4: 115,327,598	I359F	probably damaging	Het
Defb6	T	C	8: 19,225,524	L7P	probably damaging	Het
Dnah7c	A	T	1: 46,647,036	M1817L	possibly damaging	Het
Dock3	A	G	9: 106,989,465	F682S	probably damaging	Het
Enpep	T	A	3: 129,271,403	Y879F	possibly damaging	Het
Enpp2	T	C	15: 54,866,736	N462S	probably damaging	Het
Ephb3	T	C	16: 21,217,357		probably null	Het
F7	C	T	8: 13,035,215	H414Y	probably benign	Het
Fbn1	T	C	2: 125,505,455	H50R	possibly damaging	Het
Fig4	T	C	10: 41,240,637	D586G	possibly damaging	Het
Fryl	A	G	5: 73,023,988	L2825P	probably damaging	Het
Gal3st2	T	A	1: 93,872,518	H30Q	possibly damaging	Het
Gm12886	G	A	4: 121,417,474	Q70*	probably null	Het
Gm8104	A	C	14: 43,110,044	T190P	probably benign	Het
Hps3	A	T	3: 20,011,428	N749K	probably damaging	Het
Htatip2	T	A	7: 49,773,326	S210T	probably benign	Het
Ift80	T	C	3: 68,994,282		probably null	Het
Iqgap1	A	G	7: 80,760,829	V212A	possibly damaging	Het
Itih5	A	G	2: 10,238,796	E448G	probably damaging	Het
Kdm5b	T	C	1: 134,624,948	C1221R	probably damaging	Het
Lrrc72	T	C	12: 36,212,693	Y52C	probably benign	Het
Map1b	C	T	13: 99,508,140	R85Q	probably damaging	Het
Mdn1	T	C	4: 32,739,030	I3617T	possibly damaging	Het
Mtpap	T	A	18: 4,379,705	H98Q	possibly damaging	Het
Nemf	A	T	12: 69,337,959		probably null	Het
Neto1	A	T	18: 86,498,931	I458L	probably benign	Het
Nfam1	T	A	15: 83,014,962	M128L	probably benign	Het
Olfr1279	A	G	2: 111,306,921	T239A	probably damaging	Het
Olfr1383	C	A	11: 49,524,381	H219Q	probably benign	Het
Olfr501-ps1	C	T	7: 108,508,593	T179I	unknown	Het
Olfr914	A	T	9: 38,607,088	I208F	probably benign	Het
P2ry14	C	T	3: 59,116,045	G7D	probably benign	Het
Pde11a	A	G	2: 76,136,414	Y564H	probably damaging	Het
Pex5l	C	T	3: 33,004,318	V262I	probably benign	Het
Poli	A	G	18: 70,508,978	V717A	possibly damaging	Het
Prdm14	A	T	1: 13,125,559	W93R	probably damaging	Het
Rbm46	T	C	3: 82,864,121	M396V	probably benign	Het
Rcor2	T	C	19: 7,271,222	V212A	probably benign	Het
Rcor3	C	A	1: 192,137,876	G8V	probably damaging	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Skp2	T	A	15: 9,113,832	Q366L	probably damaging	Het
Slc13a3	A	T	2: 165,427,114	S312T	probably benign	Het
Sstr1	T	C	12: 58,213,356	L255P	probably damaging	Het
Steap3	T	C	1: 120,227,855	E458G	possibly damaging	Het
Sv2b	T	A	7: 75,147,713	D311V	probably damaging	Het
Tmem132b	A	G	5: 125,638,268	D347G	probably benign	Het
Tmem161a	A	G	8: 70,177,488	D108G	probably damaging	Het
Traf5	T	A	1: 191,999,831	I47F		Het
Trp53bp2	C	T	1: 182,446,568	Q95*	probably null	Het
Ttn	G	T	2: 76,877,143		probably null	Het
Usf3	T	C	16: 44,220,034	S1626P	probably benign	Het
Usp3	T	C	9: 66,566,898	R33G	probably benign	Het
Zbtb20	G	T	16: 43,610,676	A517S	probably damaging	Het

Other mutations in Hr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01805:Hr	APN	14	70565297	splice site	probably benign
IGL02020:Hr	APN	14	70556437	missense	probably benign	0.01
IGL02372:Hr	APN	14	70558350	missense	possibly damaging	0.94
IGL02380:Hr	APN	14	70557761	missense	probably damaging	0.98
IGL02554:Hr	APN	14	70559866	splice site	probably benign
IGL02949:Hr	APN	14	70559785	missense	possibly damaging	0.87
IGL03406:Hr	APN	14	70563420	critical splice donor site	probably null
angie	UTSW	14	70567833	missense	probably damaging	0.97
blofeld	UTSW	14	70568085	missense	probably damaging	1.00
general	UTSW	14	70563684	critical splice donor site	probably null
kaburo	UTSW	14		unclassified
mister_clean	UTSW	14	70560064	critical splice donor site	probably benign
mushroom	UTSW	14	70568085	missense	probably damaging	1.00
prune	UTSW	14	70571429	missense	probably damaging	1.00
ren	UTSW	14	70568085	missense	probably damaging	1.00
subclinical	UTSW	14	70561836	missense	possibly damaging	0.89
vessel	UTSW	14	70561865	nonsense	probably null
yuanxiao	UTSW	14	70571448	missense	probably damaging	1.00
R0018:Hr	UTSW	14	70558277	missense	probably benign
R0038:Hr	UTSW	14	70568085	missense	probably damaging	1.00
R0374:Hr	UTSW	14	70556476	missense	probably benign	0.01
R0511:Hr	UTSW	14	70561912	nonsense	probably null
R0609:Hr	UTSW	14	70559657	missense	probably benign
R1828:Hr	UTSW	14	70572037	critical splice donor site	probably null
R2030:Hr	UTSW	14	70571448	missense	probably damaging	1.00
R2266:Hr	UTSW	14	70558107	missense	probably benign
R2267:Hr	UTSW	14	70558107	missense	probably benign
R2268:Hr	UTSW	14	70558107	missense	probably benign
R2377:Hr	UTSW	14	70557878	missense	probably damaging	1.00
R3686:Hr	UTSW	14	70557796	missense	probably damaging	0.98
R3687:Hr	UTSW	14	70557796	missense	probably damaging	0.98
R3754:Hr	UTSW	14	70567824	missense	probably damaging	1.00
R3803:Hr	UTSW	14	70557893	missense	probably benign	0.01
R3846:Hr	UTSW	14	70571453	missense	probably damaging	1.00
R3977:Hr	UTSW	14	70563584	missense	probably benign	0.01
R3978:Hr	UTSW	14	70563584	missense	probably benign	0.01
R3979:Hr	UTSW	14	70563584	missense	probably benign	0.01
R4528:Hr	UTSW	14	70566383	missense	probably damaging	1.00
R4654:Hr	UTSW	14	70563573	missense	probably damaging	0.99
R4834:Hr	UTSW	14	70559922	missense	probably damaging	0.98
R4847:Hr	UTSW	14	70556476	missense	probably benign	0.04
R4863:Hr	UTSW	14	70571972	missense	probably damaging	1.00
R5292:Hr	UTSW	14	70571992	missense	probably damaging	1.00
R5452:Hr	UTSW	14	70556627	missense	probably damaging	1.00
R5717:Hr	UTSW	14	70566176	missense	probably benign	0.34
R5902:Hr	UTSW	14	70557791	missense	probably benign	0.02
R6000:Hr	UTSW	14	70567833	missense	probably damaging	0.97
R6439:Hr	UTSW	14	70561836	missense	possibly damaging	0.89
R6823:Hr	UTSW	14	70565374	missense	probably damaging	0.98
R7030:Hr	UTSW	14	70563684	critical splice donor site	probably null
R7213:Hr	UTSW	14	70558350	missense	probably damaging	0.99
R7468:Hr	UTSW	14	70558212	missense	possibly damaging	0.89
R7572:Hr	UTSW	14	70561853	missense	possibly damaging	0.66
R7956:Hr	UTSW	14	70559887	missense	probably benign
R7996:Hr	UTSW	14	70563603	nonsense	probably null
R7997:Hr	UTSW	14	70563603	nonsense	probably null
R8076:Hr	UTSW	14	70557941	missense	probably benign	0.00
R8101:Hr	UTSW	14	70567842	missense	possibly damaging	0.67
R8553:Hr	UTSW	14	70567525	missense	probably damaging	1.00
R8749:Hr	UTSW	14	70558070	missense	probably damaging	1.00
R8850:Hr	UTSW	14	70561865	nonsense	probably null
R8949:Hr	UTSW	14	70557888	missense	probably benign	0.01
R9139:Hr	UTSW	14	70557639	missense	possibly damaging	0.65
R9236:Hr	UTSW	14	70571956	missense	probably damaging	1.00
R9246:Hr	UTSW	14	70571475	missense	probably damaging	1.00
R9327:Hr	UTSW	14	70567788	missense	possibly damaging	0.91
R9337:Hr	UTSW	14	70559884	missense	probably benign	0.00
R9487:Hr	UTSW	14	70556437	missense	probably benign	0.01
R9487:Hr	UTSW	14	70556765	missense	possibly damaging	0.77
R9700:Hr	UTSW	14	70567176	missense	probably benign	0.00
X0025:Hr	UTSW	14	70566951	splice site	probably null
X0026:Hr	UTSW	14	70567841	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCTTCAGCACCCTATTGAACC -3'
(R):5'- GACTTCAAGACCCTTGGCTTTC -3'

Sequencing Primer
(F):5'- TTGAACCTGATCTTCCAAAGAGTCC -3'
(R):5'- AAGACCCTTGGCTTTCTATCTCCATG -3'

Posted On

2019-10-07