Incidental Mutation 'R8812:Ccne2'
ID672468
Institutional Source Beutler Lab
Gene Symbol Ccne2
Ensembl Gene ENSMUSG00000028212
Gene Namecyclin E2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8812 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location11191351-11204779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11202279 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 345 (T345A)
Ref Sequence ENSEMBL: ENSMUSP00000103960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029866] [ENSMUST00000044616] [ENSMUST00000108318] [ENSMUST00000108319] [ENSMUST00000108324] [ENSMUST00000170901]
Predicted Effect probably benign
Transcript: ENSMUST00000029866
AA Change: T344A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029866
Gene: ENSMUSG00000028212
AA Change: T344A

DomainStartEndE-ValueType
CYCLIN 146 231 2.16e-24 SMART
Cyclin_C 240 362 5.49e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044616
SMART Domains Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108318
SMART Domains Protein: ENSMUSP00000103954
Gene: ENSMUSG00000040738

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
SCOP:d1a17__ 826 961 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108319
SMART Domains Protein: ENSMUSP00000103955
Gene: ENSMUSG00000040738

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108324
AA Change: T345A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103960
Gene: ENSMUSG00000028212
AA Change: T345A

DomainStartEndE-ValueType
CYCLIN 147 232 2.16e-24 SMART
Cyclin_C 241 363 5.49e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170901
AA Change: T345A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130693
Gene: ENSMUSG00000028212
AA Change: T345A

DomainStartEndE-ValueType
CYCLIN 147 232 2.16e-24 SMART
Cyclin_C 241 363 5.49e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2. This cyclin has been shown to specifically interact with CIP/KIP family of CDK inhibitors, and plays a role in cell cycle G1/S transition. The expression of this gene peaks at the G1-S phase and exhibits a pattern of tissue specificity distinct from that of cyclin E1. A significantly increased expression level of this gene was observed in tumor-derived cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for disruptions in this gene are phenotypically normal. Male mice show reduced fertility but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,332,352 P1167Q probably damaging Het
Adcy10 A T 1: 165,551,298 Q885H probably damaging Het
Alkal2 C T 12: 30,890,056 L139F probably damaging Het
Ankrd17 A T 5: 90,293,203 M439K probably benign Het
Arl11 C A 14: 61,310,973 Y77* probably null Het
Bcas3 T C 11: 85,559,147 Y669H probably benign Het
Bpifb3 C T 2: 153,922,596 A136V probably benign Het
Btbd11 A G 10: 85,627,249 Q626R probably damaging Het
C87414 T C 5: 93,637,801 T207A possibly damaging Het
Ciz1 T C 2: 32,364,274 S76P probably benign Het
Clip4 A T 17: 71,800,805 K94* probably null Het
Cthrc1 G A 15: 39,084,471 R195H probably damaging Het
D430042O09Rik A C 7: 125,797,695 R309S probably benign Het
Ddx31 T C 2: 28,840,804 probably benign Het
Elf2 T A 3: 51,266,767 D113V possibly damaging Het
Esrrb A G 12: 86,488,550 N155S probably benign Het
Fam198b T C 3: 79,908,771 S363P possibly damaging Het
Flnb A G 14: 7,887,624 D478G probably benign Het
Galm T A 17: 80,127,786 L24H probably damaging Het
Gm14124 T A 2: 150,267,704 C105S possibly damaging Het
Gon4l G A 3: 88,895,007 G975D possibly damaging Het
Hspbp1 T G 7: 4,664,784 M237L probably benign Het
Ighv1-62-1 A T 12: 115,386,747 M100K probably damaging Het
Ipo8 A T 6: 148,775,077 D971E possibly damaging Het
Itgax C T 7: 128,133,807 A286V probably damaging Het
Jpt2 T C 17: 24,960,604 Q3R probably benign Het
Klrg2 A C 6: 38,636,903 L55R probably damaging Het
Lrp6 T A 6: 134,456,178 M1397L probably benign Het
Lrrc31 T A 3: 30,679,179 Q462L probably benign Het
Lyg2 T A 1: 37,909,973 I103F probably damaging Het
Map10 T C 8: 125,669,925 V19A probably damaging Het
Map1b T A 13: 99,432,815 M1133L unknown Het
Mrgpra4 A G 7: 47,981,733 V40A probably benign Het
Myh1 G A 11: 67,209,141 G626R probably benign Het
Myo9a T C 9: 59,779,747 V45A probably benign Het
Ncdn A G 4: 126,745,112 F638S possibly damaging Het
Ncs1 T A 2: 31,284,201 M121K probably damaging Het
Nf1 T C 11: 79,546,354 V16A probably damaging Het
Nktr T A 9: 121,750,251 D1128E unknown Het
Nup205 T G 6: 35,214,334 L1000R probably damaging Het
Obscn T C 11: 59,035,095 E5604G probably damaging Het
Olfr1240 A G 2: 89,439,865 V138A probably benign Het
Olfr1260 G T 2: 89,978,371 A198S possibly damaging Het
Olfr1370 T C 13: 21,073,050 N84D probably damaging Het
Olfr1446 A T 19: 12,890,196 V127E probably damaging Het
Olfr409-ps1 T A 11: 74,317,708 S228T unknown Het
Olfr615 G T 7: 103,560,609 C44F probably benign Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Ovch2 T A 7: 107,793,255 I294F probably damaging Het
Ovch2 A T 7: 107,794,044 C207* probably null Het
P3h2 T A 16: 25,982,717 Y397F possibly damaging Het
Pappa A T 4: 65,204,929 I834F possibly damaging Het
Pcdha11 T C 18: 37,007,663 S782P probably benign Het
Pex1 T C 5: 3,631,614 V980A probably benign Het
Pik3c2a G T 7: 116,351,877 L1258I probably damaging Het
Pmp22 T A 11: 63,158,413 *161R probably null Het
Ppp1r26 T A 2: 28,451,180 M274K probably benign Het
Ppp6r2 T C 15: 89,283,072 V830A probably benign Het
Prss1 T A 6: 41,462,586 N84K probably benign Het
Rab3il1 G A 19: 10,026,777 A18T probably damaging Het
Sbf2 A T 7: 110,329,862 S1471T probably damaging Het
Setdb1 T A 3: 95,356,060 D45V probably damaging Het
Sik3 G T 9: 46,178,513 V275L probably benign Het
Skint6 C A 4: 112,988,952 M659I probably benign Het
Slc24a1 T A 9: 64,928,703 D714V unknown Het
Slc26a5 T A 5: 21,813,882 D653V probably damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Stradb A G 1: 58,994,319 I380M probably benign Het
Sult1e1 T C 5: 87,587,642 Y59C probably benign Het
Tas2r122 C T 6: 132,711,739 A64T probably benign Het
Tep1 C T 14: 50,837,132 C1812Y probably damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trio A T 15: 27,905,225 C152S unknown Het
Tro G A X: 150,655,559 S34L unknown Het
Vmn1r15 A G 6: 57,258,138 probably benign Het
Vmn1r19 A G 6: 57,404,451 probably benign Het
Vmn1r75 A G 7: 11,880,703 T121A possibly damaging Het
Vmn2r32 A G 7: 7,474,670 F241L probably damaging Het
Vmn2r66 A G 7: 85,005,685 L472P probably damaging Het
Ylpm1 G T 12: 84,996,792 W101C unknown Het
Zdbf2 C A 1: 63,308,113 H1884N probably benign Het
Other mutations in Ccne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Ccne2 APN 4 11199322 missense probably benign 0.01
IGL02207:Ccne2 APN 4 11202261 missense probably benign 0.00
IGL02885:Ccne2 APN 4 11198723 splice site probably benign
R0367:Ccne2 UTSW 4 11201426 splice site probably benign
R0686:Ccne2 UTSW 4 11197220 missense possibly damaging 0.93
R1056:Ccne2 UTSW 4 11192707 missense probably damaging 0.99
R1068:Ccne2 UTSW 4 11192850 missense probably benign
R2076:Ccne2 UTSW 4 11197177 missense probably damaging 1.00
R2167:Ccne2 UTSW 4 11197249 missense probably benign 0.00
R2190:Ccne2 UTSW 4 11197241 missense probably benign 0.02
R3724:Ccne2 UTSW 4 11203039 missense probably benign 0.09
R3766:Ccne2 UTSW 4 11199293 splice site probably benign
R4595:Ccne2 UTSW 4 11202986 missense probably benign
R5469:Ccne2 UTSW 4 11201353 nonsense probably null
R5543:Ccne2 UTSW 4 11194026 missense probably benign 0.04
R5884:Ccne2 UTSW 4 11199411 missense probably benign 0.00
R6298:Ccne2 UTSW 4 11199306 missense probably damaging 1.00
R7493:Ccne2 UTSW 4 11198772 missense probably damaging 1.00
R7553:Ccne2 UTSW 4 11201348 missense probably benign 0.02
R7591:Ccne2 UTSW 4 11201393 missense probably benign
R7801:Ccne2 UTSW 4 11194079 critical splice donor site probably null
R7996:Ccne2 UTSW 4 11201347 missense probably benign 0.01
R8799:Ccne2 UTSW 4 11201355 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCCTCAAGAGAGTCAGATGAGTAG -3'
(R):5'- ACCCCATTAGTTTCAGGACTTAAC -3'

Sequencing Primer
(F):5'- TGTGCTACAGAATGACCCTTGAG -3'
(R):5'- GTTTCAGGACTTAACTAAATAGCACG -3'
Posted On2021-04-30