Incidental Mutation 'R5482:Ripply2'
ID434392
Institutional Source Beutler Lab
Gene Symbol Ripply2
Ensembl Gene ENSMUSG00000047897
Gene Nameripply transcriptional repressor 2
SynonymsC030002E08Rik, LOC382089
MMRRC Submission 043043-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5482 (G1)
Quality Score116
Status Validated
Chromosome9
Chromosomal Location87015537-87019917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87015567 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 8 (E8G)
Ref Sequence ENSEMBL: ENSMUSP00000055369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058846]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058846
AA Change: E8G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000055369
Gene: ENSMUSG00000047897
AA Change: E8G

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:Ripply 33 118 2.3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188187
Meta Mutation Damage Score 0.0702 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that belongs to a novel family of proteins required for vertebrate somitogenesis. Members of this family have a tetrapeptide WRPW motif that is required for interaction with the transcriptional repressor Groucho and a carboxy-terminal Ripply homology domain/Bowline-DSCR-Ledgerline conserved region required for transcriptional repression. Null mutant mice die soon after birth and display defects in axial skeleton segmentation due to defective somitogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for null mutations display neonatal lethality, rib and vertebral abnormalities, impaired somite formation, decreased body length, and short tails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,512,049 M269L probably benign Het
9230109A22Rik T C 15: 25,138,950 noncoding transcript Het
Abca15 T C 7: 120,369,147 L801P probably damaging Het
Acap3 A G 4: 155,900,156 D212G probably benign Het
Acsl6 G A 11: 54,327,138 D166N probably damaging Het
Acy1 T C 9: 106,434,639 probably benign Het
Adgrl3 A G 5: 81,794,513 N1368S probably damaging Het
Akap5 T C 12: 76,328,826 I344T probably benign Het
Aplp1 A G 7: 30,440,175 F399S probably damaging Het
Arap3 A G 18: 37,974,674 S1302P possibly damaging Het
Bik T G 15: 83,544,134 V121G probably damaging Het
Birc6 A T 17: 74,641,782 M3069L possibly damaging Het
Birc6 A G 17: 74,662,690 T4237A probably damaging Het
Btn2a2 T C 13: 23,486,387 N59D probably benign Het
Cabyr A G 18: 12,751,439 S328G possibly damaging Het
Cfap57 C T 4: 118,569,641 G1067R probably benign Het
Cryl1 A T 14: 57,313,012 F132I probably damaging Het
Dnah8 G A 17: 30,800,547 E3865K probably damaging Het
Dock3 G A 9: 106,978,738 R741* probably null Het
Fam57b A G 7: 126,827,488 T78A possibly damaging Het
Fam69a C G 5: 107,909,663 C343S probably damaging Het
Fsip2 C T 2: 82,985,310 L3796F possibly damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5535 C A 2: 144,174,572 noncoding transcript Het
Gmcl1 A T 6: 86,718,073 M202K probably damaging Het
Hecw2 T A 1: 53,926,201 M489L probably benign Het
Lrrk1 A G 7: 66,330,670 I254T probably benign Het
Lrrn3 G A 12: 41,452,387 L644F probably benign Het
Lrrn3 A C 12: 41,452,388 C643W probably damaging Het
Nr2f6 A T 8: 71,374,538 I373N probably damaging Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1448 T C 19: 12,919,905 T135A probably damaging Het
Olfr788 T C 10: 129,473,078 Y129H probably benign Het
Otogl T A 10: 107,821,941 I1043F probably damaging Het
Padi3 G A 4: 140,795,843 T302I probably damaging Het
Pcdhgb5 A G 18: 37,731,532 N127D probably damaging Het
Pign A G 1: 105,546,710 F876L probably benign Het
Pip5k1c A G 10: 81,293,063 E2G probably damaging Het
Ppp1r18 G A 17: 35,873,879 E141K probably damaging Het
Ralbp1 A C 17: 65,861,568 Y247* probably null Het
Rufy3 TAAGCA TA 5: 88,637,332 probably null Het
Skint2 T G 4: 112,625,879 C160W probably damaging Het
Sun2 C T 15: 79,737,511 R172Q probably benign Het
Syna A G 5: 134,559,174 L307P possibly damaging Het
Trappc12 T C 12: 28,691,325 K795R probably damaging Het
Ttll11 A G 2: 35,752,406 S638P probably damaging Het
Usp2 G A 9: 44,089,183 probably null Het
Vmn2r26 A T 6: 124,061,326 E620V possibly damaging Het
Wdr36 A T 18: 32,841,904 H103L probably benign Het
Wnt5b T C 6: 119,446,431 T78A probably benign Het
Zc2hc1b C T 10: 13,153,526 R146Q probably damaging Het
Other mutations in Ripply2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02686:Ripply2 APN 9 87015956 splice site probably benign
R0369:Ripply2 UTSW 9 87016319 missense probably damaging 1.00
R1438:Ripply2 UTSW 9 87019660 missense probably damaging 1.00
R4785:Ripply2 UTSW 9 87019796 missense probably damaging 1.00
R4980:Ripply2 UTSW 9 87019694 missense probably damaging 1.00
R5330:Ripply2 UTSW 9 87015638 splice site probably benign
R5331:Ripply2 UTSW 9 87015638 splice site probably benign
R5345:Ripply2 UTSW 9 87019726 unclassified probably null
R5834:Ripply2 UTSW 9 87015890 missense probably damaging 1.00
R6357:Ripply2 UTSW 9 87016278 missense possibly damaging 0.49
R7427:Ripply2 UTSW 9 87019756 missense possibly damaging 0.47
Z1177:Ripply2 UTSW 9 87019664 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGTTGCACGCGTTCACAC -3'
(R):5'- ACTCGGACTTAGTAAGGGCAC -3'

Sequencing Primer
(F):5'- GTCTGCAAGGGCTAGATA -3'
(R):5'- CCCGGGCAAAGGCAAGAG -3'
Posted On2016-10-06