Incidental Mutation 'R5482:Akap5'
ID434402
Institutional Source Beutler Lab
Gene Symbol Akap5
Ensembl Gene ENSMUSG00000021057
Gene NameA kinase (PRKA) anchor protein 5
SynonymsLOC238276, AKAP150, 3526401B18Rik
MMRRC Submission 043043-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R5482 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location76324891-76334153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76328826 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 344 (I344T)
Ref Sequence ENSEMBL: ENSMUSP00000134127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095610] [ENSMUST00000154078] [ENSMUST00000172992]
Predicted Effect probably benign
Transcript: ENSMUST00000095610
AA Change: I344T

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000093270
Gene: ENSMUSG00000021057
AA Change: I344T

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
Pfam:WSK 78 108 4.7e-13 PFAM
SCOP:d1k28a2 386 573 6e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154078
AA Change: I337T

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114495
Gene: ENSMUSG00000021057
AA Change: I337T

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
Pfam:WSK 71 101 3.3e-13 PFAM
SCOP:d1k28a2 379 566 8e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172992
AA Change: I344T

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134127
Gene: ENSMUSG00000021057
AA Change: I344T

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
Pfam:WSK 79 107 8.7e-15 PFAM
SCOP:d1k28a2 386 573 6e-21 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein binds to the RII-beta regulatory subunit of PKA, and also to protein kinase C and the phosphatase calcineurin. It is predominantly expressed in cerebral cortex and may anchor the PKA protein at postsynaptic densities (PSD) and be involved in the regulation of postsynaptic events. It is also expressed in T lymphocytes and may function to inhibit interleukin-2 transcription by disrupting calcineurin-dependent dephosphorylation of NFAT. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced long term potentiation, improved glucose handling and heightened insulin sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,512,049 M269L probably benign Het
9230109A22Rik T C 15: 25,138,950 noncoding transcript Het
Abca15 T C 7: 120,369,147 L801P probably damaging Het
Acap3 A G 4: 155,900,156 D212G probably benign Het
Acsl6 G A 11: 54,327,138 D166N probably damaging Het
Acy1 T C 9: 106,434,639 probably benign Het
Adgrl3 A G 5: 81,794,513 N1368S probably damaging Het
Aplp1 A G 7: 30,440,175 F399S probably damaging Het
Arap3 A G 18: 37,974,674 S1302P possibly damaging Het
Bik T G 15: 83,544,134 V121G probably damaging Het
Birc6 A T 17: 74,641,782 M3069L possibly damaging Het
Birc6 A G 17: 74,662,690 T4237A probably damaging Het
Btn2a2 T C 13: 23,486,387 N59D probably benign Het
Cabyr A G 18: 12,751,439 S328G possibly damaging Het
Cfap57 C T 4: 118,569,641 G1067R probably benign Het
Cryl1 A T 14: 57,313,012 F132I probably damaging Het
Dnah8 G A 17: 30,800,547 E3865K probably damaging Het
Dock3 G A 9: 106,978,738 R741* probably null Het
Fam57b A G 7: 126,827,488 T78A possibly damaging Het
Fam69a C G 5: 107,909,663 C343S probably damaging Het
Fsip2 C T 2: 82,985,310 L3796F possibly damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5535 C A 2: 144,174,572 noncoding transcript Het
Gmcl1 A T 6: 86,718,073 M202K probably damaging Het
Hecw2 T A 1: 53,926,201 M489L probably benign Het
Lrrk1 A G 7: 66,330,670 I254T probably benign Het
Lrrn3 G A 12: 41,452,387 L644F probably benign Het
Lrrn3 A C 12: 41,452,388 C643W probably damaging Het
Nr2f6 A T 8: 71,374,538 I373N probably damaging Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1448 T C 19: 12,919,905 T135A probably damaging Het
Olfr788 T C 10: 129,473,078 Y129H probably benign Het
Otogl T A 10: 107,821,941 I1043F probably damaging Het
Padi3 G A 4: 140,795,843 T302I probably damaging Het
Pcdhgb5 A G 18: 37,731,532 N127D probably damaging Het
Pign A G 1: 105,546,710 F876L probably benign Het
Pip5k1c A G 10: 81,293,063 E2G probably damaging Het
Ppp1r18 G A 17: 35,873,879 E141K probably damaging Het
Ralbp1 A C 17: 65,861,568 Y247* probably null Het
Ripply2 A G 9: 87,015,567 E8G possibly damaging Het
Rufy3 TAAGCA TA 5: 88,637,332 probably null Het
Skint2 T G 4: 112,625,879 C160W probably damaging Het
Sun2 C T 15: 79,737,511 R172Q probably benign Het
Syna A G 5: 134,559,174 L307P possibly damaging Het
Trappc12 T C 12: 28,691,325 K795R probably damaging Het
Ttll11 A G 2: 35,752,406 S638P probably damaging Het
Usp2 G A 9: 44,089,183 probably null Het
Vmn2r26 A T 6: 124,061,326 E620V possibly damaging Het
Wdr36 A T 18: 32,841,904 H103L probably benign Het
Wnt5b T C 6: 119,446,431 T78A probably benign Het
Zc2hc1b C T 10: 13,153,526 R146Q probably damaging Het
Other mutations in Akap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02194:Akap5 APN 12 76328033 missense probably damaging 0.99
IGL02309:Akap5 APN 12 76328855 missense possibly damaging 0.91
IGL02801:Akap5 APN 12 76328995 missense probably benign 0.25
IGL03136:Akap5 APN 12 76329875 nonsense probably null
PIT4802001:Akap5 UTSW 12 76329932 missense probably damaging 1.00
R1517:Akap5 UTSW 12 76329262 missense possibly damaging 0.91
R1694:Akap5 UTSW 12 76329924 missense probably damaging 0.99
R2012:Akap5 UTSW 12 76329348 missense possibly damaging 0.53
R4507:Akap5 UTSW 12 76327907 missense possibly damaging 0.91
R4755:Akap5 UTSW 12 76327807 nonsense probably null
R4893:Akap5 UTSW 12 76329969 missense probably damaging 0.99
R4905:Akap5 UTSW 12 76328433 missense probably damaging 0.96
R5886:Akap5 UTSW 12 76327845 missense possibly damaging 0.88
R7151:Akap5 UTSW 12 76328249 missense probably benign 0.08
R7413:Akap5 UTSW 12 76328904 missense possibly damaging 0.65
R7514:Akap5 UTSW 12 76328529 missense probably benign 0.00
X0067:Akap5 UTSW 12 76328198 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TAATGGCATCCGGGAAAGTG -3'
(R):5'- TGCCTGACCAACTGTAGCTTC -3'

Sequencing Primer
(F):5'- ATCCGGGAAAGTGCCCCAAG -3'
(R):5'- TCTGCCTGACCCACTGTGG -3'
Posted On2016-10-06