Incidental Mutation 'R5482:Rufy3'
ID434377
Institutional Source Beutler Lab
Gene Symbol Rufy3
Ensembl Gene ENSMUSG00000029291
Gene NameRUN and FYVE domain containing 3
SynonymsRpipx, D5Bwg0860e, 2810428M05Rik, 6330416M07Rik
MMRRC Submission 043043-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5482 (G1)
Quality Score197
Status Validated
Chromosome5
Chromosomal Location88565040-88651392 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TAAGCA to TA at 88637332 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031229] [ENSMUST00000196686] [ENSMUST00000196894] [ENSMUST00000198965] [ENSMUST00000199312]
Predicted Effect probably null
Transcript: ENSMUST00000031229
SMART Domains Protein: ENSMUSP00000031229
Gene: ENSMUSG00000029291

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
RUN 163 225 8.08e-23 SMART
coiled coil region 267 329 N/A INTRINSIC
coiled coil region 357 464 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000196686
SMART Domains Protein: ENSMUSP00000143209
Gene: ENSMUSG00000029291

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
RUN 181 243 8.08e-23 SMART
coiled coil region 285 347 N/A INTRINSIC
coiled coil region 375 482 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000196894
SMART Domains Protein: ENSMUSP00000143770
Gene: ENSMUSG00000029291

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
low complexity region 84 107 N/A INTRINSIC
RUN 213 275 8.08e-23 SMART
coiled coil region 317 379 N/A INTRINSIC
coiled coil region 407 514 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198965
SMART Domains Protein: ENSMUSP00000143302
Gene: ENSMUSG00000029291

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
low complexity region 84 107 N/A INTRINSIC
RUN 213 275 2.8e-25 SMART
coiled coil region 317 379 N/A INTRINSIC
coiled coil region 407 555 N/A INTRINSIC
FYVE 597 662 2.9e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000199312
SMART Domains Protein: ENSMUSP00000143115
Gene: ENSMUSG00000029291

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
RUN 181 243 8.08e-23 SMART
coiled coil region 285 347 N/A INTRINSIC
coiled coil region 375 482 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RPIP8, UNC-14, and NESCA domain-containing protein that is required for maintenance of neuronal polarity. In addition, it has been implicated in mediation of gastric cancer cell migration and invasion via interaction with P21-activated kinase-1, which promotes its expression. The encoded protein localizes to F-actin-enriched invadopodia to induce formation of protrusions, thereby facilitating cell migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: The gene product is involved in regulating neuronal polarity and axon growth. Homozygous KO leads to loss of neuronal polarity and causes neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,512,049 M269L probably benign Het
9230109A22Rik T C 15: 25,138,950 noncoding transcript Het
Abca15 T C 7: 120,369,147 L801P probably damaging Het
Acap3 A G 4: 155,900,156 D212G probably benign Het
Acsl6 G A 11: 54,327,138 D166N probably damaging Het
Acy1 T C 9: 106,434,639 probably benign Het
Adgrl3 A G 5: 81,794,513 N1368S probably damaging Het
Akap5 T C 12: 76,328,826 I344T probably benign Het
Aplp1 A G 7: 30,440,175 F399S probably damaging Het
Arap3 A G 18: 37,974,674 S1302P possibly damaging Het
Bik T G 15: 83,544,134 V121G probably damaging Het
Birc6 A T 17: 74,641,782 M3069L possibly damaging Het
Birc6 A G 17: 74,662,690 T4237A probably damaging Het
Btn2a2 T C 13: 23,486,387 N59D probably benign Het
Cabyr A G 18: 12,751,439 S328G possibly damaging Het
Cfap57 C T 4: 118,569,641 G1067R probably benign Het
Cryl1 A T 14: 57,313,012 F132I probably damaging Het
Dnah8 G A 17: 30,800,547 E3865K probably damaging Het
Dock3 G A 9: 106,978,738 R741* probably null Het
Fam57b A G 7: 126,827,488 T78A possibly damaging Het
Fam69a C G 5: 107,909,663 C343S probably damaging Het
Fsip2 C T 2: 82,985,310 L3796F possibly damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5535 C A 2: 144,174,572 noncoding transcript Het
Gmcl1 A T 6: 86,718,073 M202K probably damaging Het
Hecw2 T A 1: 53,926,201 M489L probably benign Het
Lrrk1 A G 7: 66,330,670 I254T probably benign Het
Lrrn3 G A 12: 41,452,387 L644F probably benign Het
Lrrn3 A C 12: 41,452,388 C643W probably damaging Het
Nr2f6 A T 8: 71,374,538 I373N probably damaging Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1448 T C 19: 12,919,905 T135A probably damaging Het
Olfr788 T C 10: 129,473,078 Y129H probably benign Het
Otogl T A 10: 107,821,941 I1043F probably damaging Het
Padi3 G A 4: 140,795,843 T302I probably damaging Het
Pcdhgb5 A G 18: 37,731,532 N127D probably damaging Het
Pign A G 1: 105,546,710 F876L probably benign Het
Pip5k1c A G 10: 81,293,063 E2G probably damaging Het
Ppp1r18 G A 17: 35,873,879 E141K probably damaging Het
Ralbp1 A C 17: 65,861,568 Y247* probably null Het
Ripply2 A G 9: 87,015,567 E8G possibly damaging Het
Skint2 T G 4: 112,625,879 C160W probably damaging Het
Sun2 C T 15: 79,737,511 R172Q probably benign Het
Syna A G 5: 134,559,174 L307P possibly damaging Het
Trappc12 T C 12: 28,691,325 K795R probably damaging Het
Ttll11 A G 2: 35,752,406 S638P probably damaging Het
Usp2 G A 9: 44,089,183 probably null Het
Vmn2r26 A T 6: 124,061,326 E620V possibly damaging Het
Wdr36 A T 18: 32,841,904 H103L probably benign Het
Wnt5b T C 6: 119,446,431 T78A probably benign Het
Zc2hc1b C T 10: 13,153,526 R146Q probably damaging Het
Other mutations in Rufy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Rufy3 APN 5 88621350 missense probably damaging 0.96
IGL01964:Rufy3 APN 5 88615070 missense probably damaging 1.00
IGL02537:Rufy3 APN 5 88640662 utr 3 prime probably benign
R0111:Rufy3 UTSW 5 88630584 missense probably damaging 1.00
R0552:Rufy3 UTSW 5 88584270 missense possibly damaging 0.79
R1441:Rufy3 UTSW 5 88632515 missense probably damaging 0.97
R1565:Rufy3 UTSW 5 88640632 missense probably damaging 1.00
R2507:Rufy3 UTSW 5 88649898 missense probably damaging 1.00
R2508:Rufy3 UTSW 5 88649898 missense probably damaging 1.00
R3707:Rufy3 UTSW 5 88643032 missense probably benign 0.28
R4907:Rufy3 UTSW 5 88584192 missense possibly damaging 0.95
R4999:Rufy3 UTSW 5 88637226 missense probably damaging 1.00
R5134:Rufy3 UTSW 5 88645567 missense probably benign 0.01
R5420:Rufy3 UTSW 5 88640659 makesense probably null
R6029:Rufy3 UTSW 5 88627255 missense probably damaging 1.00
R6254:Rufy3 UTSW 5 88584309 missense probably benign 0.01
R6444:Rufy3 UTSW 5 88637307 missense probably damaging 1.00
R7219:Rufy3 UTSW 5 88649856 missense probably benign 0.22
R7256:Rufy3 UTSW 5 88614947 missense possibly damaging 0.91
R7327:Rufy3 UTSW 5 88642952 missense probably damaging 0.99
R7352:Rufy3 UTSW 5 88637194 missense possibly damaging 0.92
R7484:Rufy3 UTSW 5 88598472 missense probably benign 0.01
R7645:Rufy3 UTSW 5 88640617 missense probably benign 0.01
R7953:Rufy3 UTSW 5 88642992 missense probably benign 0.01
R8043:Rufy3 UTSW 5 88642992 missense probably benign 0.01
X0066:Rufy3 UTSW 5 88617418 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTCTGCCAAAGGGTCTGCAC -3'
(R):5'- TGTATGACAGTCGGAGTATTCG -3'

Sequencing Primer
(F):5'- CGCTTACTTCATTGAGGAAGGAGTAC -3'
(R):5'- ATGACAGTCGGAGTATTCGTTTGTG -3'
Posted On2016-10-06